Unigene SGN-U210460

Unigene Basic Information 
Unigene ID: SGN-U210460
Unigene Build: Petunia hybrida #1
Date: 2004-03-30
Organism: P.hybrida
Alternative ID: 210460
mRNA sequence: Length: 495 bp

>SGN-U210460 Petunia hybrida #1 (1 members)
TTCATACAGGAAGCAAACGAAGAATATGGAAAGAGGATGCGAAAAGTTGTAGACAGAATTTTTAAGAGCTTGTCTCTTGGGCTTGGGCTT
GAAGGCCATGAAATGATAGAGGCAGCTGGTGGTGATGAGATAGTTTACTTGTTGAAGATCAACTATTACCCACCATGCCCAAGGCCCGAT
TTGGCTCTTGGTGTTGTGGCCCATACGGACATGTCATATATCACCATTCTTGTCCCAAATGAAGTCCAAGGCCTCCAAGTGTTCAAGGAT
GGCCATTGGTATGATGTCAAGTACATACCAAATGCCTTAATTGTCCATATTGGTGACCAAGTTGAGATTCTTAGCAATGGCAAATACAAG
AGTGTATACCATAGGACAACGGTGAACAAGGACAAGACAAGAATGTCATGGCCGGTTTTCTTGGAGCCCCCGTCAGAGCATGAAGTTGGG
CCAATTCCTAAGCTGCTTAGTGAGGCCAACCCACCCAAATTCAAG


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
Fl flavonol synthaseflavonol synthase
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E520831
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None