Unigene SGN-U210776

Unigene Basic Information 
Unigene ID: SGN-U210776
Unigene Build: Petunia hybrida #1
Date: 2004-03-30
Organism: P.hybrida
Alternative ID: 210776
mRNA sequence: Length: 505 bp

>SGN-U210776 Petunia hybrida #1 (1 members)
GATCTATTGAACAATTAGTCGTCAACTTTGATTTTGTTCATGAATGAGAGTCAATATATATGTTCTATTATAAGGAGTATCATTTTTTTA
ACAATACACACGTGTATAATAAGTGAATTAATGCAAGTCAAGTATTTCAACCCGACCCATTACCCATACCCGGTTCGATGTAATCAATAA
CAGTGTCAACAGCAGTCCAGTCTCAGGTGAATCTAACTTCAAAAAGTTTCGCCGGGAAATCAAGATTCAACCACTTCAATTTCTTTTTTA
TTTATTAAACTCCGTGCAAAGTCAAAACTATATAAATTGAGATATGGATGTTACTTTGGCAACAATATTGTTGGGAATCCTGGTAGCTGT
ACTCATTGTCATACCTCAACTTCGCAATAAATCTGTTCAGCCCAAAAAAGTTGCCTCAAGTACTCAAAACAAGGCAGTCAAAACATACAG
CAAAGCTGAAGTTGCACTGCATAACACGAGAACTGACTGCTGGATCATTATCAAA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
chsD chalcone synthase Dchalcone synthase
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E532820
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 0 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (4)  
Preceding Unigenes (0)None