Unigene SGN-U211107

Unigene Basic Information 
Unigene ID: SGN-U211107
Unigene Build: Petunia hybrida #1
Date: 2004-03-30
Organism: P.hybrida
Alternative ID: 211107
mRNA sequence: Length: 623 bp

>SGN-U211107 Petunia hybrida #1 (1 members)
ACGAGGAAACTCTAAACTCAATATTCAGGCAAAACAAGAAACGTTATGCATTATTACTCATATTTCAGTGTTTAGTGAAGAAAGAAATCA
AGAAAATATGTCAAGCACTGCTGGACAAGTCATACGCTGCAAAGCTGCAGTGGCATGGAAAGCAGGGAAGCCATTGGTGATTGAGGAAGT
TGAAGTGTCACCTCCTCAGAAAATGGAAGTTCGTCTCAAGATCCTTTACACTTCCCTCTGTCACACTGATATCTACTTCTGGGAAGCCAA
GGGCCAAAATCCAGTCTTTCCTCGTATTCTTGGGCATGAGGCTGCAGGGATTGTGGAAAGTGTTGGAGAGGGAGTAACCGAACTTGTGCC
AGGAGACCATGTTCTTCCAGTGTTCACTGGTGAATGCAAGAATTGTGCTCATTGCAAATCAGAAGAGAGCAATATGTGCAGCCTCTTGAG
AATCAACACTGATAGGGGAGTGATGATTCATGATGATCAATCAAGATTCTCCATCAACGGCAAACCGATTTACCATTTTGTTGGAACCTC
CACATTTAGTGAGTACACTGTGGTTCATGTCGGTTGTGTTGCCAAAATCAANCCTCTTGCCCCTCTTGACAAAGTCTGTGTCC


[Blast] [AA Translation]
Associated Loci (3)  
Locus symbolLocus nameGene activity
adh3 alcohol dehydrogenase 3alcohol dehydrogenase
Adh2 alcohol dehydrogenasealcohol dehydrogenase
ADH1 alcohol dehydrogenase 1alcohol dehydrogenase
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E528839
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 2 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None