Unigene SGN-U212081

Unigene Basic Information 
Unigene ID: SGN-U212081
Unigene Build: Petunia hybrida #1
Date: 2004-03-30
Organism: P.hybrida
Alternative ID: 212081
mRNA sequence: Length: 565 bp

>SGN-U212081 Petunia hybrida #1 (1 members)
GCCTAACTTCTGTATAGACAAAGAAAAAAAGAAAAGAAAATGAAAACAGCTCAAGGTGTCAGTGCAACCCTAACAATGGAAGTGGCAAGA
GTACAAGCAATAGCATCGTTAAGCAAGTGCATGGACACAATTCCATCAGAGTACATTAGGTCCGAGAATGAGCAACCAGCAGCCACAACC
CTGCATGGGGTAGTTCTTCAAGTGCCAGTGATTGACCTACGTGACCCTGATGAGAACAAGATGGTGAAGCTCATAGCTGATGCTAGCAAA
GAGTGGGGGATATTCCAACTGATCAACCATGGCATTCCTGATGAGGCTATCGCGGATTTACAGAAAGTAGGGAAAGAGTTCTTTGAACAT
GTTCCACAGGAGGAGAAAGAGCTGATTGCCAAGACTCCAGGATCAAACGACATTGAAGGCTATGGAACTTCTCTGCAGAAGGAAGTGGAA
GGCAAGAAAGGTCGGGTGGATCATTTGTTCCATAAGATTTGGCCTCCTTCTGCCGTCAACTATCGTTATCGGNCTAAAAACCCTCCTTCA
TACAGGGAAGCAAACGAAGAATATG


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
Fl flavonol synthaseflavonol synthase
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E526652
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None