Unigene SGN-U212470

Unigene Basic Information 
Unigene ID: SGN-U212470
Unigene Build: Petunia hybrida #1
Date: 2004-03-30
Organism: P.hybrida
Alternative ID: 212470
mRNA sequence: Length: 535 bp

>SGN-U212470 Petunia hybrida #1 (1 members)
GGTTGATTCATCTCGACAGAGTCTTGTGATGTGGGCAAAACCACTGTTGGAAAAGAGCAACATCAAGGAATTAGCAGATCCTCGTCTGGG
TGATGCCTATGATGTTGTTGAGATGAAAAGGGCAATGTATACAGCTTCTACATGTGTTCACCACTTACCAAACATGCGTCCCAACATGAA
ACGGGTCGTTCAGCTGTTGAAAGGCGAAAATGAACCAATAGACATGAAGCAGAAATCGACAGGAGGAAGAGCATTAATGTTCGATGTTTC
CGATTTAGATGATTACACTAGCACAACCTATCTCAACGATCTCAATCGTCATATGCAGCTTGTTATGGAGTAACTTTTTGATATTATCAT
CAAGTCTCATTGATCTTTTGTTCTGCGTCTGCTGCTGCTGTTATTTATCCTTACTCATTTTGTATATATATCTTGTAAATCAAGAGTTCA
ATCGAGTAATATTCCACTAGCTGCTTTTTGGGTTGAGAATTTTCGAGATAATCGTATATCTTAACACTGAGAAGCAGCATAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E532563
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None