Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.


This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been split into SGN-U579157, SGN-U579666, SGN-U580902, SGN-U583317, SGN-U592049, and SGN-U593348 in the current build, Tomato 200607 #2
Unigene SGN-U212581

Unigene Basic Information 
Unigene ID: SGN-U212581
Unigene Build: Lycopersicon Combined #3
Date: 2004-06-30
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 212581
mRNA sequence: Length: 1519 bp

>SGN-U212581 Lycopersicon Combined #3 (39 members)
CAGTAGTTACATTGTGCTAATGGCACATAAACCTAATGTATTTCTTTTTCCGAGGTGTATTGAAACTGTGGGAGCCATTTTTGGCTCACG
TTTATGATATTTACTCCTTAATTAAAAAAAAAAAAAAAAAACTCGCGTCCTTCTGCTCATCAATTAGCAATTAATCCAAAACCATTATGG
CTGCCAAAAATTCAGAGATGAAGTTTGCTATCTTCTTCGTTGTTCTTTTGACGACCACTTTAGTTGATATGTCTGGAATTTCGAAAATGC
AAGTGATGGCTCTTCGAGACATACCCCCACAAGAAACATTGCTGAAAATGAAGCTACTTCCCACAAATATTTTGGGACTTTGTAACGAAC
CTTGCAGCTCAAACTCTGATTGCATCGGAATTACCCTTTGCCAATTTTGTAAGGAGAAGACGGACCAGTATGGTTTAACATACCGTACAT
GCAACCTGTTGCCTTGAACAATATCAATGATCTATCGATCGATCTATCTATCTATTTATCTGTCTCTGCGCGTATAGTGTTGTCTGTACC
TTTGGTGTGAAGAATATGAATAAAGGGATACATATATCTAGATATATTCTAGGTAATGTCCTATTGTATTTAAAATTTGTAGCAATGATT
GTTTGAATAAAAACATACCATGAGTGAAATAATTATTCCAATTAAAAAAAAAAAATTCACGTATTTATTTCACTTATGATAAATATTTTT
GTTCCTTTCGCGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAACTAGTTCTCTGAGGAATCCTTCTCAATCTTCTACTAACAATCAAGACA
GAGCCGGACCATCAGATTTTCAGTCTTTTTCAGATTCTATGAAGTCTCGGTTTAGTGCAATGTCAATGAGATGCAAAGAATCTTTAACCA
AGAGTTCAAGGGGTTGGAAGGAGAGATTTTTCTCTCGCAACAGTTCAACATCAGACAATGTTCCCGAACCTAGGAATGAAGTGAGGGCAG
CTGTTGCCACTGTATCACACATGATGGACCATCTGGAAACTACAGATAGCAGAACCAGTTCTGCTGAATCAAATATACTGGACACTACTT
TACCTATCAGAGATGCTGAGCAGCATATACCTGAGAGTGATGGTATTCATTCTTTAAATGAGGATAGTAGGCAATCCCCGTGTGCTGCAA
GTGGTTCAAACTGAAGTTTTATATGAGTTGAAGCATTTTCTCTTCAAGGTAGATACTCTTGCCAGCATCGATGATATATGGTGCGCATCT
TACTGGGTGTGGTGAAACATTAATCCTTTGAAGTGCAACACTGAATGTTAAGATATAGAGGGATGGATGTCGTCATTTTGTCCAAACCAT
GTATATGTATGATTATATAGATGTAAATTGACCCATTCTGGGTAGTAGTACTGATGACTTCAACTGTTCTCTTTAATCTTACATGAAACC
CCCCTTCATAATCTTCATAGACATTGCTGGACAGTTAATTGACCAAGGTTTTCTTGGGATTCACTAGCACCAAAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (8)  
mRNA member sequences (39)  
Alignment image suppressed for unigene with 39 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (2)  
Annotations (manual: 1 | blast: 2 | go: 0 )  
Protein prediction analysis (1)  
Gene Family (3)  
Preceding Unigenes (1)