Notice: The contact form functionality has been restored. Apologies for any inconvenience.


This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been split into SGN-U578607, SGN-U578701, SGN-U581328, and SGN-U590986 in the current build, Tomato 200607 #2
Unigene SGN-U212786

Unigene Basic Information 
Unigene ID: SGN-U212786
Unigene Build: Lycopersicon Combined #3
Date: 2004-06-30
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 212786
mRNA sequence: Length: 1363 bp

>SGN-U212786 Lycopersicon Combined #3 (222 members)
ATTCATCTCTTCAATCTTTTGTATTCACATATTCTATTTATTCAATACACTTAGGAAAACACTTTACCAAGAAATTAAGATGGAGAACTT
CCCAATTATTAACTTGGAAAAGCTCAATGGAGATGAGAGAGCCAACACCATGGAAATGATCAAAGATGCTTGTGAGAATTGGGGCTTCTT
TGAGTTGGTGAACCATGGAATTCCACATGAAGTAATGGACACAGTAGAGAAAATGACAAAGGGACATTACAAGAAGTGCATGGAACAGAG
GTTTAAGGAACTAGTGGCAAGTAAGGGACTTGAGGCTGTTCAAGCTGAGGTTACTGATTTAGATTGGGAAAGCACTTTCTTCTTGCGCCA
TCTTCCTACTTCTAATATCTCTCAAGTACCCGATCTTGACGAAGAATACAGAGAGGTGATGAGAGATTTTGCTAAAAGATTGGAGAAATT
GGCTGAGGAGTTACTTGACTTACTCTGTGAAAATCTTGGACTTGAAAAAGGTTACTTGAAAAATGCCTTTTATGGATCAAAAGGTCCCAA
CTTTGGTACTAAAGTTAGCAACTATCCACCATGTCCTAAGCCCGATTTGATCAAGGGACTCCGCGCTCATACAGACGCAGGAGGCATCAT
ACTTCTGTTCCAAGATGACAAAGTGAGTGGCCTTCAACTCCTCAAAGACGAGCAATGGATCGATGTTCCTCCCATGCGCCACTCTATTGT
GGTTAACCTTGGTGACCAACTTGAGGTGATCACTAACGGGAAGTACAAGAGTGTGCTGCACAGAGTAATTGCACAAACAGACGGGACACG
AATGTCATTAGCCTCATTTTACAATCCAGGAAGTGATGCAGTAATATATCCAGCAAAAACTTTGGTTGAAAAAGAGGCAGAGGAAAGTAC
ACAAGTGTATCCAAAGTTTGTGTTTGATGATTACATGAAGTTATATGCTGGACTCAAGTTTCAAGCCAAAGAGCCAAGATTTGAAGCAAT
GAAGGCAATGGAAAGTGATCCAATTGCAAGTGCTTAGATCCCAATTCAATTAAAAAAATTGGTGTTTGAAAAATATATTTAAATATAGCA
ATCTATGTATACACATTATTTGCTCTTCTTATGTATGGTAGAATAAAGTTAGTATTAAAAAAGATTGTGATTTGCTGCATATGTATCAAA
AAGAGTCCTAATATTTGTATCTATAAATAAGGTGCCTTCTAGTGAAATTATACAAATAATAATTTGGAGTGAAAAAAAAAAAAAAAAAAA
TTGTTCTTTCTCATGTAATTTAACTTTTAAGTATCTTACTTTACAATATACTGTTCACTTATTGAACATATTGAGTGAAAAAAAAAAAAA
AAAAAACTCGAGA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (15)  
mRNA member sequences (222)  
Alignment image suppressed for unigene with 222 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (13)  
Annotations (manual: 5 | blast: 2 | go: 0 )  
Protein prediction analysis (1)  
Gene Family (3)  
Preceding Unigenes (1)