Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.


This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been split into SGN-U580375, SGN-U580527, and SGN-U590050 in the current build, Tomato 200607 #2
Unigene SGN-U212843

Unigene Basic Information 
Unigene ID: SGN-U212843
Unigene Build: Lycopersicon Combined #3
Date: 2004-06-30
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 212843
mRNA sequence: Length: 1939 bp

>SGN-U212843 Lycopersicon Combined #3 (174 members)
AATTGCATTCTCCATTCTTGGAAGTGGCCATTCTTGATTTCTTGAAACAAAGTGTTTTTGTTATATACAGGGGGTGGAGTTAGAGGGTAA
GTTACGCATTTAGTCTTGAACTTTAGTCTGACTTCTTGAAACAAAGAAATTCAGAGTGGCCATTGTTGAAAGAGAGGGTGGAATTTGTAA
GTCAAGAAACAGGTTACTCCTGTTTGAGTGAGGAAAAGTTGGTTTGCCTGTCTGTGGTCTTTTTATAATCTTTTTCTACAGAAGAGAAAG
TGGGTAATTTTGTTTGAGAGTGGAAATATTCTCTAGTGGGAATCTACTAGGAGTAATTTATTTTCTATAAACTAAGTAAAGTTTGGAAGG
TGACAAAAAGAAAGACAAAAATCTTGGAATTGTTTTAGACAACCAAGGTTTTCTTGCTCAGAATGTCTGTTGCCTTGTTATGGGTTGTTT
CTCCTTGTGACGTCTCAAATGGGACAAGTTTCATGGAATCAGTCCGGGAGGGAAACCGTTTTTTTGATTCATCGAGGCATAGGAATTTGG
TGTCCAATGAGAGAATCAATAGAGGTGGTGGAAAGCAAACTAATAATGGACGGAAATTTTCTGTACGGTCTGCTATTTTGGCTACTCCAT
CTGGAGAACGGACGATGACATCGGAACAGATGGTCTATGATGTGGTTTTGAGGCAGGCAGCCTTGGTGAAGAGGCAACTGAGATCTACCA
ATGAGTTAGAAGTGAAGCCGGATATACCTATTCCGGGGAATTTGGGCTTGTTGAGTGAAGCATATGATAGGTGTGGTGAAGTATGTGCAG
AGTATGCAAAGACGTTTAACTTAGGAACTATGCTAATGACTCCCGAGAGAAGAAGGGCTATCTGGGCAATATATGTATGGTGCAGAAGAA
CAGATGAACTTGTTGATGGCCCAAACGCATCATATATTACCCCGGCAGCCTTAGATAGGTGGGAAAATAGGCTAGAAGATGTTTTCAATG
GGCGGCCATTTGACATGCTCGATGGTGCTTTGTCCGATACAGTTTCTAACTTTCCAGTTGATATTCAGCCATTCAGAGATATGATTGAAG
GAATGCGTATGGACTTGAGAAAATCGAGATACAAAAACTTCGACGAACTATACCTTTATTGTTATTATGTTGCTGGTACGGTTGGGTTGA
TGAGTGTTCCAATTATGGGTATCGCCCCTGAATCAAAGGCAACAACAGAGAGCGTATATAATGCTGCTTTGGCTCTGGGGATCGCAAATC
AATTAACTAACATACTCAGAGATGTTGGAGAAGATGCCAGAAGAGGAAGAGTCTACTTGCCTCAAGATGAATTAGCACAGGCAGGTCTAT
CCGATGAAGATATATTTGCTGGAAGGGTGACCGATAAATGGAGAATCTTTATGAAGAAACAAATACATAGGGCAAGAAAGTTCTTTGATG
AGGCAGAGAAAGGCGTGACAGAATTGAGCTCAGCTAGTAGATTCCCTGTATGGGCATCTTTGGTCTTGTACCGCAAAATACTAGATGAGA
TTGAAGCCAATGACTACAACAACTTCACAAAGAGAGCATATGTGAGCAAATCAAAGAAGTTGATTGCATTACCTATTGCATATGCAAAAT
CTCTTGTGCCTCCTACAAAAACTGCCTCTCTTCAAAGATAAAGCATGAAATGAAGATATATATATATATATATATAGCAATATACATTAG
AAGAAAAAAAGGAAGAAGAAATGTTGTTGTATTGATATAAATGTATATCATAAATATTAGGTTGTAGTAACATTCAATATAATTATCTCT
TGTAGTTGTTGTATCTTCACTTTATCTCAACTCCTTTGAGAGAACTTTCCGTAAAAAAAAAAAAACTTGGTTACTCAGAATTTTACTGTG
GGCATGATAATTGATATACCAAATTCAGTTTTGATTCTATCGAAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (8)  
mRNA member sequences (174)  
Alignment image suppressed for unigene with 174 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (19)  
Annotations (manual: 11 | blast: 2 | go: 2 )  
Protein prediction analysis (1)  
Gene Family (3)  
Preceding Unigenes (1)