Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.


This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been split into SGN-U578671, SGN-U581242, and SGN-U590914 in the current build, Tomato 200607 #2
Unigene SGN-U212908

Unigene Basic Information 
Unigene ID: SGN-U212908
Unigene Build: Lycopersicon Combined #3
Date: 2004-06-30
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 212908
mRNA sequence: Length: 1258 bp

>SGN-U212908 Lycopersicon Combined #3 (44 members)
GCGTGTCGCCCAAAAGATATACTCTATACTACTGCCGTCTACCGATTTCACCGCTATATATTCATTTCCTATACAATCTGTTTTCGCAGG
TTTTGTTCCAATTTCAAGGTGTTGTTGCTTCCCCAATTCACAGAGAATTGAAATTGGTGAATTTGATATGGCTGGGAAGATTATGCATGC
TGTTCAGTACGACTCTTATGGCGGTGGAGCCGCTGCCTTGAAGCATGTGGAAGTTCCTGTCCCAACTCCGAAGAAGGATGAGGTCTTGCT
AAAACTCGAGGCTGCAAGCATAAATCCTGTTGACTGGAAAATTCAGAAGGGCGTGCTTCGTCCCCTTCTTCCTACCAAGTTTCCTTTTAT
TCCTACTACCGACGTGGGAGGAGAGGTTGTAGAGGTAGGATCTAATGTAAAAAGCTTCAAGGCTGGTGACAAGGTTGTGGCTATGCTCAA
TACCCTGAATGGAGGTGGATTGGCTGAATATGCGGTGGCTAATGAGAGTTTGACTGTTCCAAGACCCGCTGAAGTATCAGCTGCAGAAGG
TGCAGGTCTTGTTATTGCAGGTCTTACAGCTCTTCAGGCCCTTGTCAATCCTGCTGAGGTTAAGCTCGATGGAACTGGACCCCGGAAGAA
CATTCTAGTTACGGCTGCCTCAGGTGGTGTCGGTCACTATGCTGTTCAATTGGCAAAACTTGGTAACACTCATGTTACTGCCACCTGCGG
AGTGCGCAACATTGATCTTGTGAAGAGCTTAGGAGCAGATGAGGTTCTTGATTACAATACCCCAGAGGGAGCAGCTCTTAAGAGTCCGTC
AGGCCAAAAATATGATGCAGTGATTCACTGCACAACAGGCATCCCTTGGTCTACCTTTGAGCCTAATTTAAGTTCAAGTGGAAAGGTTAT
AGATATAACTCCTGGAGTTAGCGCCATGTGGACCTTTGCGGTGAAGAAATTGACCTTCTCAAAGAAACAGCTGGTGCCACTGCTTCTGAT
TCCGAAGAAGGAAAATCTGGAATTGATTGTTGGGCTTGTGAAGGAAGGGAAACTGAAAACAGTAATCGACTCAAAATTTCCTCTGAGCAA
GGCTGAAGATGCTTGGAGCAAGAGTATTGATGGACATGCCACCGGAAAGATTATTGTGGAGCCATAGAGCAGTGTTCTCCCAAATTATGT
AATAAAATGTTTGCGAGGCTTGTGCAGTATGACCAATTAAATATATTCAGCTGTAACAACTTCGATTTGCCTCCTATGTATCATCTAC


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (11)  
mRNA member sequences (44)  
Alignment image suppressed for unigene with 44 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (4)  
Annotations (manual: 0 | blast: 2 | go: 2 )  
Protein prediction analysis (1)  
Gene Family (3)  
Preceding Unigenes (3)