Sol Genomics Network

This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been superseded by SGN-U579338 in the current build, Tomato 200607 #2

Unigene SGN-U213013

Unigene Basic Information

Unigene ID:	SGN-U213013
Unigene Build:	Lycopersicon Combined #3
Date:	2004-06-30
Organism:	S.lycopersicum S.habrochaites S.pennellii
Alternative ID:	213013
mRNA sequence:	Length: 775 bp

>SGN-U213013 Lycopersicon Combined #3 (96 members)
CTGGTTCTCCACAGCAAACACAGAGAAGTTCATAGCAGAAGAAGAGAGAGATTTAGCTATGTCTGATGAAGAACACCATTTTGAGTCCAA
AGCTGATGCTGGTGCCTCAAAAACTTACCCTCAACAAGCTGGTACTATTCGCAAGAATGGTTATATAGTTATCAAAGGCAGACCTTGCAA
GGTTGTTGAGGTCTCCACTTCCAAAACTGGCAAGCATGGACATGCAAAATGTCACTTTGTGGCAATCGACATTTTCAATGCAAAAAAGCT
TGAAGATATTGTTCCTTCATCCCACAATTGTGATGTGCCACATGTCAATCGTACTGACTATCAGCTGATTGACATATCTGAAGATGGTTT
TGTGTCTCTTCTTACTGAAAATGGAAACACCAAAGACGACCTCAGACTTCCCACCGATGACACCCTGTTGAACCAGGTTAAAGGTGGATT
TGAGGAAGGAAAGGATCTCGTTCTGTCTGTGATGTCTGCAATGGGTGAAGAGCAGATCTGTGCTGTGAAGGACATTGGTACCAAGACCTA
GTTGTGTGCATTCTGCAGCATAAATAATTGCTTTTTAGCGAAGACGTTTTATATCTTGTTATCGTGGTACCTTTGCAATCTGTTTTATCG
TGAAAACACCTTATATCTATTGGCATGGCTTGAATAGTTGAAACTCTATAATAGTTTCTGTTTGGCATAAGGCAATGAACTGGATTTGAT
AGCAGAAGTAATCTACATGTCACTTTTTTTTTACTTGAAAAAAAAAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (21)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	7
Solanum lycopersicum	cLEB	vegetative shoots including meristems and small expanidng leaves 8 weeks	898	1
Solanum lycopersicum	cLEC	combined undifferentiated and shooting callus 7-10 days post germination	14114	2
Solanum lycopersicum	cLED	ovary 5 days pre-anthesis to 5 days post-anthesis	9878	1
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	2
Solanum lycopersicum	cLEG	fruit pericarp breaker fruit	15207	2
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	17
Solanum lycopersicum	cLEN	fruit pericarp red ripe to over-ripe	3979	3
Solanum lycopersicum	cLER	leaf 4 weeks	5127	4
Solanum lycopersicum	cLES	leaf 4 weeks	5243	6
Solanum lycopersicum	cLET	leaf 4-6 weeks	9135	12
Solanum lycopersicum	cLEW	mixed roots grown under different nutrient and mineral difficiencies 4-8 weeks	3175	4
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	3
Solanum lycopersicum	cLEZ	root germinating seedlings	2373	2
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	3
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	3
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	2
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	6
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	6
Solanum lycopersicum	cTOS	suspension cultures	8026	9
Solanum lycopersicum	cTSC	seed	2256	1

mRNA member sequences (96)

Alignment image suppressed for unigene with 96 aligned sequences.
[Show Image]

Markers Information (1)

Expression Data (2)

Annotations (manual: 1 | blast: 2 | go: 2 )

Protein prediction analysis (1)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	124	RuBisCO_small	107
2	22316	KOW EIF5A_hypusine	35
5	56536	KOW EIF5A_hypusine	33

Preceding Unigenes (1)

Unigene	Build
SGN-U143567	Lycopersicon Combined #2

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer