This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been split into SGN-U577594, SGN-U578449, SGN-U579973, and SGN-U580784 in the current build, Tomato 200607 #2
Unigene SGN-U213035

Unigene Basic Information 
Unigene ID: SGN-U213035
Unigene Build: Lycopersicon Combined #3
Date: 2004-06-30
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 213035
mRNA sequence: Length: 1719 bp

>SGN-U213035 Lycopersicon Combined #3 (115 members)
TTTTTTTTTTTTTTTTTAGTCCAGCAAATTAATGAATGTTGCTATTCAGACAACAATTGGTTCGTATTCCACATATATAAATACCACAAC
AGTTGCTCCTAAAACCATATACACATTGTTTTTGTTTCCATAAAACAAACCAAAAGGCAAAAAGCTAAAGTGTTTCACAACTTCTTTTTC
ACAATCTTTGAACATTCAACTTCTTTTCTCAATTACACCAATCAAATATTCAAAACGTAGTTCTCCAAGCTCCGAATTAAAATGGAGCCT
TAAACACCAATACTCAGCTGATGAGATGTTCAGATAGCAGTAGAATAGATACACGGTGGAAGTAAATGCGGCACGTCAGCAACATCTTCG
TCTAGTTCCTCATTATGCCAAAGCCTTAATTTCATATTACAGAATACAAACATCTGATTATTTTCATCTTTCATTCCATTCATATACTCT
GTGCAAGATTGGAATCCAAGGCTGTGTTGTTTGACTAGTTTGTGAGCATAGCTACATCTATGAATACACATGGTTTTCTCTTCTACAAAA
TAATAGAATTCCTCAGCATAATCAGTGCTTGTGCTCTGCTCGTGCCATTCGTTTAACCTTATCGCATTTCCATTTCTGCTTCTTCAGAAC
AATTACTATGGGTAAGTGCTATCCTACTGTGAGCGAGGAGTACCTCAAGGCTGTTGACAAATGTAAAAGGAAACTCAGAGGACTCATTGC
TGAGAAGAATTGTGCTCCTATTATGCTCCGTCTTGCATGGCACTCTGCTGGTACCTACGATGTGTGTTCCAAAACTGGTGGTCCTTTTGG
TACCATGAGGTTCAAAGCGGAGCTAGCACATGGTGCAAACAATGGTCTTGACATTGCTCTCAGACTCTTGGAGCCCATTAGGGAGCAGTT
TCCCACCCTCTCCCATGCTGATTTCCATCAGTTGGCTGGTGTTGTTGCTGTTGAAGTTACTGGAGGACCTGATGTTCCCTTTCACCCTGG
CAGAGAGGACAAGCCAGAGCCACCAGTGGAAGGTCGCTTGCCGGATGCCACCAAGGGCTGTGACCACTTGAGAGACGTGTTCAAGAAACA
AATGGGTCTTTCTGACCAGGATATTGTTGCACTCTCTGGTGCCCATACCTTGGGAAGGGCACACAAGGAGCGTTCTGGTTTTGAAGGACC
TTGGACTGCCAATCCCCTTATCTTTGACAATTCATACTTCACGGAGCTTTTGAGTGGGGAAAAAGAGGGGCTCTTACAGTTGCCGTCAGA
CAAGGCTCTCCTTTGTGATCCTGCTTTCCGTCCCCTTGTTGAGAAATATGCTGCGGATGAAGATGCCTTCTTTGCTGACTATGCTGAGGC
TCACTTGAAGCTTTCTGAATTGGGATTTGCTGAAGCTTAAGATGCTGATTGGAAGAGCTGGGAGTGGTGACATATTTTTGTTAATGGTTC
ATTTCTGAAAAGCTTGCTGGAGCTGTTGTTTTTGCTGCTCTTTATATATCATGATTTAAATTTGGCAGCTACGTTAGACGATGATATTGT
GACACTCTTCCAGCTTATTAATAAATTTCTAGTATTTTGTTTTTGTAAAAAAAAAAAAAAAAAAATTTTAAATTAATTACTTGGCTGAAC
TTGGTATGTTAAGGAAAAAAATGCACTCAGTTGTCTAGGAAGACTTGCGTGATTGAGAACAACATAGAATTATTGGACTGATTCTATCCA
GTCATGTAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (21)  
mRNA member sequences (115)  
Alignment image suppressed for unigene with 115 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 2 | blast: 2 | go: 2 )  
Protein prediction analysis (1)  
Gene Family (3)  
Preceding Unigenes (5)