Sol Genomics Network

This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been split into SGN-U578139 and SGN-U592723 in the current build, Tomato 200607 #2

Unigene SGN-U213066

Unigene Basic Information

Unigene ID:	SGN-U213066
Unigene Build:	Lycopersicon Combined #3
Date:	2004-06-30
Organism:	S.lycopersicum S.habrochaites S.pennellii
Alternative ID:	213066
mRNA sequence:	Length: 1214 bp

>SGN-U213066 Lycopersicon Combined #3 (48 members)
GCACGAGGTGAAACCCTAAAAGCAGAGGAAGCTAAGGGAGAGTAACAGAGCACACCAATGGCGGCAATCACACAGCAACCAAGGACATTG
ACGACGAAAGAGGCTGACATACAGCTGATGTTGGCAGCTGAAGTCCACCTCGGTACTAAGAACTGTGACTTCCAAATGGAACGTTACGTC
TTCAAGCGTCGCAACGACGGTATCTACATTATTAACGCTGGAAAGACATGGGATAAGCTGCATATGGCAGCTAGAGTTATTGTTTCTATT
GAGAATCCTCAGGACATCATTGTGCAATCTGCCAGGCCTTATGGGCAGAGAGCCGTCTTGAAGTTCGCACAATATACTGGTGCACATGCT
ATTGCTGGCCGTCACACCCCTGGTACCTTTACCAATCAGCTTCAGACTTCATACAGCGAGCCAAGACTTCTCATTCTCACTGACCCAAGA
ACTGATCACCAGCCTATTAAGGAAGCTGCTCTTGGAAACATCCCCACTATTGCCTTCTGTGACACTGATTCACCCATGCGATATGTTGAC
ATTGGTATCCCTGCCAACAACAAAGGAAAGCACAGCATTGGTGTTCTCTTTTGGATCTTAGCAAGGATGGTACTACAGATGCGTGGTACC
ATTAGTCCTGGACCCAAGTGGGATGTCATGGTGGATCTCTTCTTTTACAGAGAGCCTGAAGAGGCAAAAGAGCAACAAGATGAGGAAGTA
CCTGCTATTGCTGATTATGCAGAATATGGTGGCGCTGCTCTTGGTGGTGATTGGACTAGCAGCCAAATCCCTGATGCCCAATGGGCTGCA
GATGGTGCAACATCTGTTCCTGCAGCTACTGGTGACTGGTCTGGAGATGCAGTGGTTGAGGGAGGTTGGGATGCTGCAGCTGCTCCTCCT
GCTGGTGTACCAGAAGTGACCCCTGCTCCAGCTGCTGCTACTGGCTGGGAATGAACTTGACTCCTTCAGAGAGTTCTTTTTTGTTAATTT
AGATGTGAGTTCTTGTTACAGACGGTTTTGTTTACAATGCAATTTATAAAAATTTTGGACTTGTTGATGTACGAAATTATTTTTAATCAT
TTATAGCATGTCTTTTTAGTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAN
TTTGGGGGGGGGGGCCCGCCCCCCCCCCCCCCCTAGGGGGGGGT

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (16)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	cLEB	vegetative shoots including meristems and small expanidng leaves 8 weeks	898	1
Solanum lycopersicum	cLEC	combined undifferentiated and shooting callus 7-10 days post germination	14114	2
Solanum lycopersicum	cLED	ovary 5 days pre-anthesis to 5 days post-anthesis	9878	2
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	1
Solanum lycopersicum	cLEI	whole seedlings germinating seed	3927	2
Solanum lycopersicum	cLEL	developing flower buds and flowers anthesis-stage flowers from full grown plants, 4-8 weeks old	11276	8
Solanum lycopersicum	cLEM	fruit immature green fruit	4240	5
Solanum lycopersicum	cLEW	mixed roots grown under different nutrient and mineral difficiencies 4-8 weeks	3175	2
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	4
Solanum lycopersicum	cLEY	root pre-anthesis/pre-fruit loading	3259	1
Solanum lycopersicum	cTOA	developing flower buds and flowers 0-3mm flower buds from full grown plants	6259	3
Solanum lycopersicum	cTOB	developing flower buds and flowers 3-8mm flower buds from full grown plants	5524	3
Solanum lycopersicum	cTOC	developing flower buds and flowers 8mm to pre-anthesis flower buds from full grown plants	5759	4
Solanum lycopersicum	cTOE	Crown gall crown galls from full-grown plants (4-8 wks old)	5204	3
Solanum lycopersicum	cTOF	shoot developing shoots from 4-6wks old plants	9122	6
Solanum lycopersicum	cTSB	seed	1880	1

mRNA member sequences (48)

Alignment image suppressed for unigene with 48 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 1 | blast: 2 | go: 5 )

Protein prediction analysis (1)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	1387	Ribosomal_S2_b/o Ribosomal_S2 Ribosomal_S2_e/a	13
2	23313	Ribosomal_S2_b/o Ribosomal_S2 Ribosomal_S2_e/a	13
5	57395	Ribosomal_S2_b/o Ribosomal_S2 Ribosomal_S2_e/a	13

Preceding Unigenes (2)

Unigene	Build
SGN-U143649	Lycopersicon Combined #2
SGN-U160679	Lycopersicon Combined #2

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer