Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.


This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been split into SGN-U577711, SGN-U579208, and SGN-U579547 in the current build, Tomato 200607 #2
Unigene SGN-U213130

Unigene Basic Information 
Unigene ID: SGN-U213130
Unigene Build: Lycopersicon Combined #3
Date: 2004-06-30
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 213130
mRNA sequence: Length: 1724 bp

>SGN-U213130 Lycopersicon Combined #3 (66 members)
GCCACAAGTCATCATCCGTTTGCCGGTGCTTTTCAGATCCATTTTCATTTCCTTTTCGTTGATTAAAAATGGCCGACGGTGAGGATATTC
AGCCCCTTGTTTGTGACAATGGAACTGGAATGGTTAAGGCAGGATTTGCTGGTGATGATGCTCCTCGAGCAGTGTTTCCCAGTATTGTGG
GTCGTCCCAGGCACACAGGTGTTATGGTCGGAATGGGACAGAAGGATGCGTATGTGGGTGATGAAGCTCAATCTAAGAGAGGTATCTTGA
CCTTGAAATATCCCATTGAGCATGGTATAGTCAGCAATTGGGATGATATGGAGAAGATATGGCATCATACTTTTTACAATGAGCTTCGAG
TTGCTCCTGAGGAACACCCTGTTCTCCTGACTGAGGCACCCCTTAATCCCAAGGCCAACAGAGAGAAGATGACCCAGATTATGTTTGAGA
CATTTAATGTTCCTGCTATGTATGTTGCTATCCAGGCTGTGCTTTCTCTGTATGCTAGCGGTCGTACCACTGGTATTGTGTTGGACTCTG
GTGATGGTGTTAGTCACACTGTCCCTATCTATGAAGGTTATGCTTTACCACATGCCATTCTTCGTTTGGACCTTGCTGGTCGTGACCTTA
CTGATAGCTTGATGAAGATCCTCACCGAGAGAGGTTACATGTTCACCACTACTGCTGAACGGGAAATTGTACGTGACATGAAGGAAAAGC
TTGCTTATGTGGCTCTTGACTACGAGCAGGAACTTGAAACCGCTAGGAGCAGTTCCTCCATTGAAAAGAACTATGAGTTGCCAGATGGAC
AGGTTATTACCATTGGTGCTGAGAGGTTCCGTTGCCCAGAGGTACTCTTCCAACCATCAATGATTGGAATGGAAGCTGCGGGTATCCATG
AGACTACATACAACTCCATCATGAAATGTGATGTAGATATTAGGAAGGACCTCTATGGTAACATTGTTCTCAGTGGTGGCTCCACCATGT
TCCCTGGTATTGCTGATCGGATGAGCAAGGAAATCACTGCTTTGGCTCCAAGCAGCATGAAAATTAAGGTTGTTGCACCACCTGAGAGGA
AGTACAGTGTCTGGATTGGAGGATCCATTCTTGCATCCCTCAGCACATTCCAGCAGATGTGGATCTCAAAGGGCGAGTATGATGAGTCTG
GTCCTTCCATTGTCCACAGAAAGTGCTTCTAAGGTGCTGCTATAATTACTTAAAAGTGCGAGTGTCCTGTCTGTTTCCCGGTTTTGCTAT
TATGTTGCCAGTCAATTTGTTTTTTTGATGGGATGGAGAAGTTTGGTGGTGGGGGCTATGAATGCACGGTAGCAAACAACAGATTGCCAG
TATTATCTCATGTTTCCATTTAATGTGGTTAATATTCTCTACATACTTGAGAGGTGCCTGATGCATTGCCCTCTTCTGTCTGGCTACACC
ATCCCTTGGTCGAAGCGTCTCTTTTTTAGGTTGTTTGTAGTTGAAGGAGAGTGATTGTGATGTTTTCTCCTCGTCTTTTCTCTCATTTTC
TCCTTTTATCTGATTTTGCACTTTTGTGGTTCTTTTTTTTCTTGGACCCAATAATGTCAATATTTATTGAATGAGAAAATTCCTATATCA
TATCAGTTTGAGGAAATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAC
ACCCCCCCGCCCGC


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (20)  
mRNA member sequences (66)  
Alignment image suppressed for unigene with 66 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (11)  
Annotations (manual: 2 | blast: 2 | go: 5 )  
Protein prediction analysis (1)  
Gene Family (3)  
Preceding Unigenes (1)