This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been split into SGN-U579050 and SGN-U591487 in the current build, Tomato 200607 #2
Unigene SGN-U213231

Unigene Basic Information 
Unigene ID: SGN-U213231
Unigene Build: Lycopersicon Combined #3
Date: 2004-06-30
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 213231
mRNA sequence: Length: 2431 bp

>SGN-U213231 Lycopersicon Combined #3 (91 members)
ATTCGGCACGAGGGTTCCTCTCTTCTATAACAAATTTCTCCAAATCCGTAGATCTTACGATTTCAAAGATGGTGTCGGATGCGGCGAAGA
AGAGAGATGCGCAGAAGAAGGCGGCGGCAGCTGCTAGGAGAGGAGGTAAAGGTGCGGCAGCGCCTAAATCGGCTGCAACCGCGTCTAAAT
CGGCGGTGGAAAGTAACGGGGTTGATAATTTGACGAATGGAGTAGGGGATCTACAGATATCTGATCGGACTTGTACGGGTGTTTTGTGTT
CACATCCGCTATCGAGGGATATTCGGATAGAGTCATTATCAGTCACTTTCCACGGACATGATCTCATCGTTGATTCTGAACTGGAGCTCA
ACTATGGCAGACGTTATGGTTTGTTGGGATTGAATGGCTGCGGGAAGTCTACTCTTCTTACTGCTATAGGGTTGAGGGAACTTCCCATCC
CAGACCACATGGATATTTTTCATCTTTCTCGGGAGATTGAAGCCTCTGACATGACCTCTCTCGAGGCTGTCATTAATTGTGATGAAGAGA
GGTTGCAATTGGAGAAAGAAGCTGAAGCTTTGGCTGGACAGGACGATGGTGGTGGAGAGCAACTTGAACGGATCTATGAGCGTTTAGAAG
CTATGGATGCTGCCACTGCTGAGAAACGTGCTGCTGAAATCTTGTTTGGGCTTGGATTTGATAAGAAAATGCAAGCAAAGAAAACACGTG
ATTTTTCCGGTGGCTGGAGGATGAGGATTGCTCTTGCCCGTGCCCTCTTTATGAATCCAACAATTTTGTTGCTTGATGAGCCAACAAACC
ATCTTGACCTAGAGGCCTGTGTGTGGTTAGAAGAATCCTTGAAGAACTTTGAGCGCATTCTGGTTGTCATTTCACACTCACAGGATTTTC
TCAATGGTGTGTGTACCAATATCATCCACATGCAAAACAAGAAGTTAAAACTCTATACAGGTAACTACGACCAATATGTGCAAACCCGTT
CAGAGCTGGAAGAAAACCAGATGAAACAGTACAAGTGGGAGCAGGAGCAGATTTCTGCAATGAAGGAATACATTGCTCGCTTTGGGCACG
GTTCAGCTAAACTAGCCCGTCAAGCACAGAGTAAAGAGAAGACATTGGCTAAGATGGAGCGTGGTGGGCTTACTGAGAAGGTGGGGAGGG
ACAGTGTCCTGGTTTTCCGGTTTACTGATGTCGGCAAACTTCCTCCTCCAGTTCTACAGTTTTCAGAAGTTGCTTTTGGCTACACACCTG
ATAACCTCATCTACAAGAACCTTGATTTTGGTGTAGATCTCGACTCCAGGATAGCACTTGTGGGGCCTAATGGAGCTGGAAAGAGCACAC
TGCTTAAGCTGATGATAGGGGATTTATTTCCCACTGATGGCATGGTTAAGCGGCATAATCACCTAAAAATTGCGCAGTACCACCAGCACT
TGGCTGAGAAGCTAGACATGGAGGTGTCAGCTCTTTTGTTTATGATGAGAGAGTACCCTGGGAACGAGGAGGAGAAGATGAGGGCAGCAA
TTGGGAGGTTTGGACTCACAGGTAAAGCTCAAGTAATGGCAATGAAGAACTTGTCAGATGGTCAACGTAGTCGAGTGATTTTTGCATGGT
TGGCTTTTAGGCAACCCCACATGCTGCTGTTGGATGAGCCAACCAACCATCTTGATATTGAAACCATTGACTCACTTGCAGAGGCCTTGA
ACGCATGGGATGGTGGGATGGTTCTAGTGAGTCACGACTTTAGGCTCATAAACCAGGTGGCCCATGAGATATGGGTATGTGAAAATCAGG
CTGTGACACGATGGGAGGGTGGCATCATGGATTTCAAGAAACACTTGAAGAAAAGGGCTGGATTGGGTGATTAAAATTAAGATCAATGTG
TTCTATATTAGAAAGTGTGATGGTATCACTATTTCCTCTTGGTGGTTCAGCGCCAAGGCGTAATGGTGAAAAACATCAGCAGGGGCCCCA
TCACGGTAGCTGAGGAGAGAAAGTGAAGGCTTCTTGATCACCAGTAAGACCTAAGTAACGTTAGCTAAGACCACGCCTGGTGCTAGAGAG
AGTAAGTGATCGAACTATGGTCACTGACTGTTTGAACTCTGGCTATTGTTCGGGCTTAGTCCACTATTTTTGTCGTCCATTTTACTCTAA
TTACATATTACCGTAGGTTTTGGAGAACATACATTACAGCTTATTCCTTGTGTCATTTCTATTCTATATCATTGCTATAATGTACTTCGT
ATTTTTGAATTCTGATTATGGATTTTTTAAATATATCTGTTTCTATTTTATCTTCAAGGCAAGTAGAATCAGCAGGTTGTTGAGCCATTA
TCTTGTTCACAACACTTGGAACGTTATTATTTTGTAGACTTGAAATTGGAGGTAGATAATATGCTTATATACGAGAATCAATTTAAACCT
C


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (22)  
mRNA member sequences (91)  
Alignment image suppressed for unigene with 91 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (2)  
Annotations (manual: 2 | blast: 2 | go: 4 )  
Protein prediction analysis (1)  
Gene Family (3)  
Preceding Unigenes (1)