This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been split into SGN-U574380, SGN-U574381, and SGN-U594426 in the current build, Tomato 200607 #2
Unigene SGN-U213460

Unigene Basic Information 
Unigene ID: SGN-U213460
Unigene Build: Lycopersicon Combined #3
Date: 2004-06-30
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 213460
mRNA sequence: Length: 1267 bp

>SGN-U213460 Lycopersicon Combined #3 (56 members)
TGGACTGTGGTTGATGTTAGGCAGTGATAGGCTGATAGCAGCACTAGCAACTTTCACTGTTTTATCTTCTCCAATAATTTCTGTTGCCAT
TAGGGACTGAACACTTGCCAGCGAAACAGCAATGGCGGCGGCAAGAATCATGGTATCAGCCAGCAACACTTTAACGGCTTCGCTCCTATC
GAAAGGTCCATTACGAAGGCCCAACAATTTCAGCCTTTGCTTCAGAAACGGACCGGTGCAAAAGAAGCGTCTTTTCACTTGCAGTGCAAT
CTACAATCCCCAGATTCAGACTATAGAAGAAGGACAGCCAGAAACCCTAGATTACCGCGTGTTTTTTGCAGACAATTCCGGCAAAAAGAT
ATCCCCTTGGCATGACATACCACTACATTTGGGTGATGGTGTTTTCAATTTTGTTGTTGAGATCCCCAAAGAATCAAGTGCAAAGATGGA
AGTTGCTACAGATGAGCAACACACTCCTATTAAACAAGACACAAAGAAGGGGAAACTTCGATACTATCCATATAATATTCACTGGAACTA
TGGATTGCTTCCTCAAACATGGGAAGATCCTACTTTTGCGAATACCGAAGTTGAAGGGGCATTAGGTGATAATGACCCTGTTGATGTTGT
TGAGATTGGGGATAGCCGAGGTAAAATTGGCCAGGTTCTGAAGGTCAAACCTTTAGCTGCTCTGGCAATGATTGATGAAGGAGAACTTGA
CTGGAAAATAGTTGCTATTTCACTAGATGATCCAAGAGCTTCACTTGTTAATGATGTTGATGATGTGGAAAAACATTTTCCGGGCACTCT
CACAGCAATCAGGGACTGGTTTAGAGACTATAAGATACCTGATGGAAAACCTGCTAATAGGTTTGCTCTTGGCAACAAGCCAGCAAACAA
GGATTACGCTCTTAAGATTATTACGGAAACCAATGAATCTTGGGCAAAGCTGGTCAAGAGATCAATCGCTGCTGGTGAGCTTTCACTTGT
ATAGTGATTAATAGAGCTCTTAAGCCTCCTGCTTGTAACCTAAACTGGACATGGAAAATGTCCCCATGATTGTACTCTTTCGTCTGGGGT
GGAAGCCAATTCATATTTTAAAGAAAGACTTCTTTGTTATAAGCTACTGTTTTTCATTTATCATCAATAATTTTGTTCATCCAGTAGCAT
TTGTAAGTTATCCAGAACGAAAACAAGTGTATTGACATATGATTTAATCTTCATTCTCCAGATGCATCAATTGAAAATTAAAAAAAAAAA
AAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (16)  
mRNA member sequences (56)  
Alignment image suppressed for unigene with 56 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (1)  
Annotations (manual: 1 | blast: 2 | go: 6 )  
Protein prediction analysis (1)  
Gene Family (3)  
Preceding Unigenes (1)