This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been superseded by SGN-U578468 in the current build, Tomato 200607 #2
Unigene SGN-U213595

Unigene Basic Information 
Unigene ID: SGN-U213595
Unigene Build: Lycopersicon Combined #3
Date: 2004-06-30
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 213595
mRNA sequence: Length: 1997 bp

>SGN-U213595 Lycopersicon Combined #3 (39 members)
TAAACTCTGCAATCCAATTATTAGTTGTTTGTCCTCAAGTTTTCAAGATGTCGGATGCTAAGGCCCCCGTGGCCACTGCTTACCCTAAGA
GGAAGATCCAGTTGGTGGACTTCCTTCTTTCGTTCCGATGGATCATTGTCATCTTTTTTGTCCTTCCATTCTCGTTCTTGTATTACTTCT
CGATATATCTAGGGGATGTGAAATCCGAGAGGAAATCTTACAAGCAACGCCAGATGGAACACGATGAGAATGTTAAAGAGGTTGTGAAGC
GTCTTGGCCAGAGGAATGCAGAAAAGGATGGTCTTGTATGCACAGCCAGACCTCCTTGGGTGGTTGTTGGAATGAGAAATGTCGACTATA
AACGTGCTCGTCATTTTGAAGTTGATCTTTCAAAGTTTAGAAATATACTTGATATTGACACGGAGCGGATGGTTGCTAAAGTTGAGCCTC
TAGTCAATATGGGCCAAATGTCAAGGGTCACTATCCCAATGAATCTTTCCCTTGCAGTTCTCGCTGAGCTCGATGATCTTACCGTTGGTG
GTTTGATCAATGGGTTCGGGGTTGAAGGAAGTTCTCACATATTTGGGTTGTTCTCTGACACTGTTGTAGCACTTGAGGTTGTTCTAGCTG
ATGGAAAGGTTGTTAGAGCTACAAAGGACAACGAATATTCTGATCTTTTCTACGCTATTCCGTGGTCTCAAGGAACATTGGGGCTTCTTG
TTTCAGCTGAAATCAAGCTTATACCAGTTGATCAATACGTGAAACTTACCTACAAACCTGTAAGGGGTAATCTTAAAGAGCTTGCTCAAG
CTTACGCGGATTCTTTTGCACCTAAAGATGGAGATCAGGACAATCCTTCTAAAGTTCCTGAGATGGTAGAAGGCATGATTTATGGTCCAA
CCGAAGGGGTTATGATGACCGGTATGTATGCTTCGAGGAATGAAGCCAAACGAAGGGGTAATGTAATCAACAATTACGGTTGGTGGTTCA
AACCATGGTTTTACCAACACGCTCAAACCGCACTAAAAAGAGGGGAATTTGTTGAGTACATTCCAACTAGGGACTACTACCACAGACACA
CGAGATCGTTGTATTGGGAAGGTAAACTAATTCTTCCATTCGGTGATCAGTTCTGGTTTAGGTTCCTCTTAGGATGGCTCATGCCACCAA
AGATTGCTCTGCTCAAAGCCACACAAAGTGAGGCTATTAGAAACTATTACCATGACCATCATGTCATTCAAGATCTCCTTGTTCCTCTTT
ACAAGGTCGGTGATTGTCTCGAGTGGGTTCATCGCGAGATGGAGGTATATCCAATTTGGCTGTGCCCACACAGAATTTACAAGCTGCCAG
TGAGACCAATGATCTACCCTGAACCAGGATTCGAGAAACACAAAAGGCAGGGTGACACCGAATATGCACAAATGTATACTGATGTTGGTG
TGTACTATGTTCCGGGAGCAGTCCTGAGGGGTGAGCCGTTTGATGGTTCAGAGAAATGCCGACAACTTGAGCTTTGGTTGATAGAGAACC
ATGGATTTCAGGCTCAATACGCGGTGACTGAGCTGACAGAGAAGAATTTCTGGAGGATGTTTGATAACGGTCTGTACGAGCAATGCAGAA
GGAAGTACAAAGCTATCGGAACGTTCATGAGTGTGTACTATAAATCGAAGAAAGGAAGGAAGACAGAGAAGGAAGTGCAGGAAGCTGAGC
AAGAGAAAGCTGAACAAGAGACTCCTGAAGCAAATTGATTCCGAAGAATAGTAGAATTTCTATGACTTTTTTTATTTTTTTTTATTTTTT
ATGATCGTCTGTTTAGTTGGTTTCTAGTATGAATTTTCGCCTTTTAAATAAGCAGCTACATTGAACAAGTATTTTACTAGTAGTAAGGTC
TGCTTGCCTGTTCCAAATTCAAAAAATGTTTCAAATAATAATGGCTAGTGCAGTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (10)  
mRNA member sequences (39)  
Alignment image suppressed for unigene with 39 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 3 | blast: 2 | go: 1 )  
Protein prediction analysis (1)  
Gene Family (3)  
Preceding Unigenes (1)