This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been split into SGN-U578010, SGN-U579241, and SGN-U590329 in the current build, Tomato 200607 #2
Unigene SGN-U213990

Unigene Basic Information 
Unigene ID: SGN-U213990
Unigene Build: Lycopersicon Combined #3
Date: 2004-06-30
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 213990
mRNA sequence: Length: 904 bp

>SGN-U213990 Lycopersicon Combined #3 (45 members)
AAAATCAAGAACCGAACCTCTCAAAAAAAGATTTGTTTTTTTTACAACTGCAAAATCCCAAGTTGAAGAAGAAGAAGCCATGGCCAACAT
GATGATGAGCTCCTCCAAAGTTTTAATCACTTCTTCATCCTCCACCATCCCTCCATCACCAAGATTCAAACTTTCCCTCACCCAAATCCC
TTTTCCAAAACTACCCCTCCCCAAATCACCCAAATCCCTTGAAACCCTTTCAATCCCATCAACTCTCAAGTCCATTTCTGTCATTCTTGC
AAGCTCATTGGCCATGGCACCACCTTCGCTAGCAGAGGAAATTGAAAAAGCTTCCCTTTTTGACTTCAACTTGACACTCCCAATCATGAT
GGCTGAATTCCTCTTTCTCATGTTTGCTTTAGACAAGATTTACTTCAGCCCATTAGGGAAATTCATGGATGAAAGAGATTCTGCCATTAA
GGAGAAATTGAGCAGTGTGAAGGACACCTCTGCTGAAGTGAAGCAACTGGAAGACCAGGCTGCTGCAATTATGAAGGCTGCAAGGGCTGA
GATATCAGCAGCATTGAACAAGATGAAGAAAGAGACTCAGCAAGAAGTAGAGCAGAAGATTGCAGAAGGAAGGAAGAAAGTTGAGGCTGA
ATTGCAAGAAGCTTTGGCTAGCTTAGAGAGTCAAAAGGAGGAGACAATCAAGAGTCTTGATTCTCAGATTGCTGCCCTTAGTGATGAGAT
TGTCAAGAAAGTCCTTCCTGTCAGTAACTAATTCTGAAAAGTTGTAATGTCTTTTTCTTGGGATTGGTAAGAGTTAACAGCTTGTTTGGA
TGGATGCTTCTTACATGTAATATTGTACCGTGTTGTTAGTTTAAATACAAATGTTTATTTTGATTGTTCATTAAAAAAAAAAAAAAAAAA
AAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (12)  
mRNA member sequences (45)  
Alignment image suppressed for unigene with 45 aligned sequences.
[Show Image]
Markers Information (1)  
Expression Data (2)  
Annotations (manual: 1 | blast: 2 | go: 3 )  
Protein prediction analysis (1)  
Gene Family (3)  
Preceding Unigenes (1)