This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been split into SGN-U583624 and SGN-U587567 in the current build, Tomato 200607 #2
Unigene SGN-U214000

Unigene Basic Information 
Unigene ID: SGN-U214000
Unigene Build: Lycopersicon Combined #3
Date: 2004-06-30
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 214000
mRNA sequence: Length: 1445 bp

>SGN-U214000 Lycopersicon Combined #3 (42 members)
TCTTCCACTCATTTCATTGTCTATATTCTTCTTCTTTTCTACTTTCTCCTCCCATTTTTCCCATTACAAACACTACATTTTTCTGTTTTT
GATTGAAAGTTTTCATTTTTAGTATTTTGGACTAAATCACCTGCTTTGGGTTTTCTTGATTTTTGCAGGGTTTTTCTTTTTTGTCTGACT
GACCCTTTTGGGGGTATTTTCGAATCTTGAAAAGTTCTGAGTTCTCTTCATAAAAAGCTTCAAGACACTATTTTTTCAATTTTTCTTGTG
TGAAACTCAAATGGGTATGTCTTGAATTAGTGTTAGGAGGCAAAGAGTTAAGTAATAAAAGATAAAAAGATGAAGATACAGTGTGATGTG
TGTGAGAAAGCTCAAGCTACTGTGATTTGCTGTGCTGATGAGGCTGCTCTGTGTGCAAAATGTGATATTGAAGTTCATGCTGCTAATAAA
TTAGCAAGCAAGCACCAAAGGCTTCATCTTCAGTGCCTATCTAACAAGCTTCCTCCTTGTGATATTTGCCAAGATAAAGCAGCCTTCATC
TTCTGTGTTGAGGATAGAGCTCTCTTTTGCAAGGACTGTGACGAAGCAATTCATTCAGCCAGCAGCCTCGCTAAGAACCACCAACGCTTC
TTAGCCACTGGAATCCGTGTAGCCTTGAGCTCAAGCTGTAATAAGGAATCAGTAAAAAACCAACTGCAGCCACAACCACCTCAGCAGAAT
TCCCAACAAGTTGGCTTGAAAATGCCTCCACAGCAGTTGTCCTGTATAACATCACCATCTTGGCCTGTCGATGATTTACTAGGATTTCCA
GATTATGAGTCGAGTGACAAGAAGGATCTACTTGAGCTTGGTGAATTTGAGTGGTTAGGGGGCATTGATCTCTTTGGTGAACAAACAGCA
GCTGAAGTGCCCGAGCTATCAGTACCTCAGTCGAGCAATACAAATATTTACAGGACAACCAAATATCAAATGCCTTACAAGAAGTCCAGA
ATTGAAATCCCAGATGATGATGAGTATTTTACTGTCCCCGATCTTGGTTGAACTCCAACTTCAAGAAGTTTCCAATTAAATGTGCATGTG
TGCTTGTGTGTAGTACTTAATCAGTGCTCTCATACTGTCAACAGATATGTTCAGTAAGTAGAAAAAGTATTGTTCTGCTTAAGATACTCC
TTATCTTGCTTACTTTCGCAGTGCGCTCATATTGTCAACAGACATGTTCAGTAAGTAGAGGAAACACTATTCTGCTTAAGATATCCTTTA
TCTTGCTTAAAAAAAAAAAAAAAAAAAGAATTGCATCAATTTCTTCTTCTTATAGCAATTTTATAAACATATTGATGCATTCTTGGACAT
GCTATGCATATTGCTACATAGTAAAATCTGGTTTTGTCACAGACAAGAGGATTACAGACATGAACCATAATCAACAGGCAACTAAGGTTG
GAACC


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (11)  
mRNA member sequences (42)  
Alignment image suppressed for unigene with 42 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (1)  
Annotations (manual: 1 | blast: 2 | go: 3 )  
Protein prediction analysis (1)  
Gene Family (3)  
Preceding Unigenes (1)