This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been split into SGN-U564570 and SGN-U564571 in the current build, Tomato 200607 #2
Unigene SGN-U214067

Unigene Basic Information 
Unigene ID: SGN-U214067
Unigene Build: Lycopersicon Combined #3
Date: 2004-06-30
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 214067
mRNA sequence: Length: 1635 bp

>SGN-U214067 Lycopersicon Combined #3 (44 members)
AACCATGGCTTCAATTGCTCTCAAAACTTTCATCGGCCTCCGTCAATCCTCGCCGGAAAACAACTCTATTAAAATCTCTAAATCCCTCCC
TACCAACCACACCCACCGTAGGCTACGTATCAATGCTTCGAAGTCCAGCCCAAGAGTCACCGGCAGAAACCTTCGCGTTGCGGTGATTGG
TGGTGGTCCTGCTGGTGGCGCCGCTGCAGAGACGCTCGCTAAGGGTGGAATTGAGACCTTTTTGATAGAACGCAAGATGGACAACTGCAA
ACCCTGCGGTGGTGCCATCCCACTCTGCATGGTGGGCGAATTCGATCTACCTCTCGATATCATCGATCGGAAAGTTACCAAGATGAAGAT
GATTTCCCCATCCAACGTCGCCGTCGATATCGGACAGACTCTGAAGCCTCACGAGTATATCGGTATGGTGCGCCGCGAAGTACTCGATGC
CTACCTCCGGGACCGTGCTGCTGAAGCCGGAGCTTCTGTTCTCAACGGCTTGTTTCTCAGAATGGACATGCCAAAAGCCCCAAATTCACC
ATACGTCCTACACTACACATCTTACGATTCCAAAACTAACGGCGCCGGTGAGAAGTGCACCCTGGAAGTTGACGCCGTTATCGGCGCAGA
CGGCGCAAATTCCCGTGTCGCAAAATCCATCAACGCTGGGGACTACGAGTACGCCATTGCCTTCCAGGAACGAATTAGAATTTCCGATGA
TAAAATGAAGTACTACGAGAATTTAGCTGAAATGTATGTCGGCGATGACGTATCCCCTGATTTTTACGGTTGGGTTTTCCCTAAATGTGA
CCACGTTGCCGTCGGCACAGGCACCGTTACCCACAAAGCAGACATTAAGAAATTCCAGCTAGCCACAAGACTGAGAGCCGATTCCAAAAT
CACCGGCGGAAAAATCATCCGAGTTGAGGCTCATCCAATTCCAGAACACCCAAGGCCAAGAAGATTACAAGACAGAGTCGCATTAGTTGG
GGATGCAGCAGGATACGTGACGAAATGTTCAGGCGAAGGGATCTACTTCGCGGCGAAGAGTGGACGTATGTGTGCTGAAGCAATTGTTGA
AGGATCAGAAAATGGGAAGAGAATGGTGGACGAGAGTGATTTGAGGAAGTACTTGGAGAAATGGGACAAGACTTACTGGCCAACATACAA
GGTGCTTGATATCTTGCAGAAGGTATTTTACAGGTCGAATCCAGCAAGAGAAGCTTTCGTGGAGATGTGCGCTGATGAGTATGTGCAGAA
GATGACATTCGACAGCTATTTGTACAAGAAAGTTGCACCAGGAAACCCCATTGAAGACTTGAAGCTTGCTGTGAATACCATTGGAAGTTT
GGTGAGGGCTAATGCACTAAGAAGGGAAATGGACAAACTCAGTGTATAAGAAGAGGATAAAATTTCATAGTAGCTAATATTTTGTAAACT
TGATTTGTAATTGAAGTATTTATGCCTTTTATCGAATTTCATGTTAAAAAAAAAAAAAAAAAAATTGTTGAAGCTAGTTTAAACTTCGAA
TTTGGACTAAACTTCTAAAGCTTAGATAAGTGAATAATGAGATTGTACTGATATATGATTTTATACAGGAAACAAAGATTAATTTTTTTT
AAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (15)  
mRNA member sequences (44)  
Alignment image suppressed for unigene with 44 aligned sequences.
[Show Image]
Markers Information (1)  
Expression Data (8)  
Annotations (manual: 3 | blast: 2 | go: 4 )  
Protein prediction analysis (1)  
Gene Family (3)  
Preceding Unigenes (1)