This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been superseded by SGN-U580350 in the current build, Tomato 200607 #2
Unigene SGN-U214228

Unigene Basic Information 
Unigene ID: SGN-U214228
Unigene Build: Lycopersicon Combined #3
Date: 2004-06-30
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 214228
mRNA sequence: Length: 1611 bp

>SGN-U214228 Lycopersicon Combined #3 (41 members)
GAAAGAGAGAGAACAGAATCTCAACTTCTTTTCTCTCTCTCTACCGGAATTCAAATCGGAAAATCAGACAAATGGCCGACGAACCTGCGT
TGACTCGATGGACCTTTCCGTTTGGGAGGAGGAAGGTTCCTGCACGAGATGCAACTGACAATGGTGATTCTGTGCAAAATGGAAATTCTT
CAACTATGAATGGAAATGGATCTGTGCGGAACACTGCAGAATTATCCATTTTCGAGCAGTATAATCAGGCTAATGGAGTTCAGTCTGCCG
GAGTGGATGGAAAACCGGAAAAATCTCTACTTCCTCCTTTCGAGTCTGCAGAAATGCGCACTTTAGCAGAAAGCTTAACCAGGGATATTC
TTCGTGGTAATCCAGATGTTAAGTGGGAGAGCATTAAAGGATTAGAGACTGCCAAGCGTCTACTAAAAGAAGCAGTTGTCATGCCTATTA
AATATCCAAAGTATTTTAAAGGTCTTTTAACTCCTTGGAAAGGTATCCTCCTTTTTGGCCCTCCTGGAACAGGAAAGACCATGCTTGCGA
AGGCAGTTGCAACTGAATGCAATACCACATTTTTCAATATCTCAGCATCATCAGTTGTTAGCAAATGGCGTGGTGATTCTGAAAAATTGA
TAAAAGTGTTATTCGAGCTCGCTAGGCATCATGCTCCTTCAACCATCTTTCTCGATGAAATTGATGCCATTATCAGTCAACGCGGGGAAG
CGCGCAGTGAGCATGAATCTAGTAGGCGTTTAAAAACAGAACTGCTCATACAGATGGACGGTTTGAATCGGACAGATGAACTTGTCTTTG
TTCTTGCTGCAACAAATCTTCCCTGGGAACTGGATGCAGCAATGCTCCGACGTCTTGAGAAGCGGATCCTTGTGCCCCTTCCGGAGGCAG
AAGCAAGGTGCGGGATGTTTGAGGATTTACTACCATCCCTTCCTGAAGAGGCGCCACTTCCATATGATTTATTGGTAGAAAAGACAGAAG
GCTTTTCTGGTTCTGATATTCGGCTATTATGCAAGGAGGCTGCCATGCAACCATTACGACGTCTAATGGCAGAACTTGATAAGAGGGAAG
AATTGGTGCCTGAGGATGAGTTGCCCAATGTTGGACCAATAACTGTGACAGATATCGAGGTGGCACTGAAGAACACGAGACCATCTGCAC
ACCTACATGCACCTAGGTACGATAAGTTCAATTCAGATTATGGCAGCCATGCTCTCCAGTGAAGGCACCCTGTTGTATCCTCTCATTTCT
GCTGTTGTCCCGTGATCTATTCAGCAATGTGCCAACACAGATGTTAAGTTTTTAACACCTGTGTTTGTAAAATGTATGACTCTGTTGTGT
GTTGAGCAATTTAGCTTTAGTGTGCTCAATTCTTATTCATGTTTTTCTTCTATGGTTGCATAAACTATGTTCTTTCACAACTGGAAACGT
CGTTCTTTATTTCTTTCTTCAGGCTTATGTTTCTCCTATAGAAACTCTATTGTAACGAGCATTTAGAAATGTTCGTATTGTTACCTCATG
TCGTCTCTACATTTACTCCCAAATAATATCATCGAAATTGTTGTCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (16)  
mRNA member sequences (41)  
Alignment image suppressed for unigene with 41 aligned sequences.
[Show Image]
Markers Information (1)  
Expression Data (0)  
Annotations (manual: 1 | blast: 2 | go: 3 )  
Protein prediction analysis (1)  
Gene Family (3)  
Preceding Unigenes (1)