This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been split into SGN-U578526 and SGN-U591749 in the current build, Tomato 200607 #2
Unigene SGN-U215004

Unigene Basic Information 
Unigene ID: SGN-U215004
Unigene Build: Lycopersicon Combined #3
Date: 2004-06-30
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 215004
mRNA sequence: Length: 1404 bp

>SGN-U215004 Lycopersicon Combined #3 (28 members)
AGATGAAGAAAAATGAAAAATGTCCAAGAAATGAGTGATCATCCATCCTCTCATTAGATAATTCCCAATTTAACCATCCTTCTATATAGT
GCTTATTCAAAACAAAGATAACATAGGAATAAACAGACAATGAAAAATCTTAGTTTAGATAATTAGTAGTAGTAACATAACATAACATAG
TTGTTATATATATATATATATATATAATATAAAAATAAAAGTAAACACTCTTTTACTTTATAAATACCTATCCCTTAGTCCAAAGTCTCT
TCCATTTTCTGCATCTACAAAATCCTCTTCATATATTATATACTAATTTGCAACCAAAAAACTTAAAAATCTTCTCTTTCCTTTCCTTAC
AAGGTGAAGTAATGGACTTCCAAAGTGATCTAACCAGAGAGATCTCACCACAAAGGAAACTAGGAAGGGGGAAAATTGAGATCAAAAGGA
TCGAAAACACGACGAATCGACAAGTAACATTCTGCAAGAGGCGCAATGGTTTGCTTAAAAAGGCTTATGAATTGTCTGTGCTCTGTGATG
CTGAGGTTGCTTTGGTTGTCTTCTCAAACAGAGGCAGACTCTATGAGTATGCCAACAACAGTGTGAAAGCAACAATCGAGAGGTACAAGA
AAGCATGCTCAGATTCCTCAAACACTGGTTCAGTATCCGAGGCCAATGCTCAGTATTACCAGCAAGAAGCCTCCAAACTGCGCGCACAAA
TTGGAAATCTGATGAACCAAAACAGGAACATGATGGGTGAAGCTCTTGCTGGAATGAAACTCAAAGAACTGAAGAATCTGGAGCAAAGAA
TTGAAAAAGGGATTAGCAAAATCCGATCCAAAAAGAATGAGCTGTTGTTTGCTGAAATTGAGTATATGCAGAAGAGGGAAGTTGATTTAC
ACAACAACAATCAGTACCTGAGAGCAAAGATTGCTGAAACTGAGAGAGCTCAGCATCAGCATCAGCAGATGAACTTGATGCCAGGGAGTT
CATCAAACTATCATGAGCTTGTGCCTCCACCTCAGCAATTCGATACTCGAAACTATCTACAAGTTAATGGATTGCAAACCAACAACCATT
ACCCTAGACAAGACCAACCCCCTATTCAACTAGTCTAATGTGCTTGAGAGATTGTCTTCTTTCTGATGTGATCTACATATAATCCACAAA
AGAAGACTGCTATTAAGCTTGAAGATTAATGGAACTTAAGTATGTATACCATATTATTAATTACTTGTTGCATGAGCTAAGACTCTTGAA
TATTGTATGTTAATTAAGTGGACATGTATTTTTTTTGCTTGGTGTACTTCCTTTTCTGCCAGTGAACTATGAAGAATTAAGCTTGTTATA
TTAAGTTCACAACTGTTTTTCTGTCCAAAAAAAAAAAAAAAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (7)  
mRNA member sequences (28)  
Alignment image suppressed for unigene with 28 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (5)  
Annotations (manual: 3 | blast: 2 | go: 4 )  
Protein prediction analysis (1)  
Gene Family (3)  
Preceding Unigenes (1)