This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been superseded by SGN-U579086 in the current build, Tomato 200607 #2
Unigene SGN-U215318

Unigene Basic Information 
Unigene ID: SGN-U215318
Unigene Build: Lycopersicon Combined #3
Date: 2004-06-30
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 215318
mRNA sequence: Length: 944 bp

>SGN-U215318 Lycopersicon Combined #3 (25 members)
ATCTCTCTACTAGAAGCATTTAGAAATTAAAAATAATCGAAAATGGCTCTTCGGACTTTAGTGAGCAGACGGACCTTAGCGGCAGGGCTA
GGGTTCCGCCAACAACTTCGTGGCGTTCAAACCTTTTCGCTCCCCGATCTCCCATACGACTATGGCGCCCTGGAGCCGGCAATTAGCGGT
GATATAATGCAGCTCCACCACCAGAAGCATCATCAGACTTACATCACTAATTACAATAAGGCCCTTGAACAGCTCCATGATGCCATCTCC
AAAGGAGATGCTCCTGCCGTCGCCAAATTGCACAGTGCCCTCAAATTTAACGGCGGAGGTCATATTAATCACTCAATTTTCTGGAATAAC
CTTGCCCCTGTCAGCGAAGGTGGTGGGGAGCCTCCAAAGGGTTCTCTTGGCTGGGCTATTGACACTAACTTTGGTTCACTGGAAGCTTTA
GTAAAAAAGATGAACGCAGAAGGTGCTGCTTTACAGGGCTCTGGCTGGGTGTGGCTTGGTGTGGACAAAGAGCTTAAGCGCCTGGTGGTT
GAAACCACTGCAAATCAGGACCCTTTGGTTTCTAAAGGAGCAAATTTGGTACCTCTTCTGGGTATAGACGTTTGGGAACACGCATACTAC
TTGCAGTACAAAAATGTAAGACCAGATTACCTGAAGAATATATGGAAAGTTATCAACTGGAAATATGCCAATGATGTTTACGAAAATGAG
TGCCCCTGAACAGGGACCATGTTTGTAAAAGCTTATGATGTGAAATAATAGCTGAGTGACACGAGCAACCTATTTTTCTCAAGTTTTAGT
TGCTGGTTGATGTAATCGATGTATGGATCCCAAATAAAACTACTTTTTATCTCGTGAGTTGTGACTCAGTTTCTTGGACATCCAGTTCAT
GCAAATATAGTAACAGGTTGAAGTTAAAAAAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (16)  
mRNA member sequences (25)  
Alignment image suppressed for unigene with 25 aligned sequences.
[Show Image]
Markers Information (1)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 3 )  
Protein prediction analysis (1)  
Gene Family (3)  
Preceding Unigenes (1)