This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been superseded by SGN-U582565 in the current build, Tomato 200607 #2
Unigene SGN-U215414

Unigene Basic Information 
Unigene ID: SGN-U215414
Unigene Build: Lycopersicon Combined #3
Date: 2004-06-30
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 215414
mRNA sequence: Length: 1271 bp

>SGN-U215414 Lycopersicon Combined #3 (24 members)
AAATAAAATTTTTCATAATTTGTGTTTATTTTACTTTTTAGAAATTTCCTAAAATGGTTCATGATAAGCAAGTAAAAGATGTAGTTTCCG
GTTGGCTTACAGTTTTTGACGACGGTTCGGTAGACCGGACATGGACTGGTCCACCTGAAGTCAAGTTCATGGCTGAGCCTGTTCCACCGC
ATGACGACTTCATTGACGGCGTTGCCGTCAAAGATGTGGTCGCCGGGGAGAATTCCGGTAGTCGTTTCCGTATTTACTTACCTGAACGTA
ATGATAGTTCGGTTGATAAGCTTCCCGTCATTCTTCACTTCCACGGCGGTGGTTTTTGTATCAGCCAAGCTGATTGGTTCATGTACTATG
CTGTCTACACTCGCTTAGCGCGTGTGGCAAACGCTATTGTTGTTTCCGTCTTCCTACCTCTGGCGCCGGAGCACCGCCTCCCTGCCGCTT
GTGATGCCGGCTTCGCCGGCCTCCTCTGGCTCCGTGACGTATCCCGGGAACAAGGTCACGAGCCCTGGCTCAACGAATACGCCGATTTCA
ACCGCGTATTCCTCATCGGAGACAGCTCCGGCGGAAACGTCGTCCATCAAGTTGCCGCCAGAGCCGGAGAAGAAGACTTATCTCCGATGA
AGCTCGCCGGCGCAATCCCGATCCATCCAGGCTTCATGCGATCCCAGCGAAGCAAATCGGAGCTAGAACAGGAACAAACCCCCTTTCTAA
CCTTAGATATGGTGGATAAATTTATGGAACTGGCTTTACCGATTGGTAGCACTAAGGATCACCCGATCACTTGTCCGATGGGTGATGCGG
CACCGGCGGTGGAGGAGCTGAAATTGCCGCCTTACTTGTACTGTGTAGCGGAGAAGGATCTGATAAAAGACACTGAAATGGAATTTTACG
AATCACTGAAAACAGGGGAAAAAGATGTTGAACTGTTGATTAACAATGGCGTGGGACACAGTTTTTACCTGAACAAAATTGCTGTTGATA
TGGACCCTGTTACTGGTTCTGCAACTGAAAAGCTTTTTGAAGCCATTGCAGAGTTCATCAACAAGCACTGATCAAATGAGAAATTAATTT
ACTATAAGATTTATGAGTGCAAATAAGCATGATATTTTATGAGAATTTTTTTGCATGCTGAACATCTGAAACGATTGTATTTATGTTTGT
TTTGATGATTGTTATTTTAACTATATCGTATCCAATTATAAAATAAAAAAATTTCATAATAATCGATATGATCGGACTACAACTTTATCA
TAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (8)  
mRNA member sequences (24)  
Alignment image suppressed for unigene with 24 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (9)  
Annotations (manual: 2 | blast: 2 | go: 0 )  
Protein prediction analysis (1)  
Gene Family (3)  
Preceding Unigenes (1)