This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been split into SGN-U563999, SGN-U564004, SGN-U564012, and SGN-U586643 in the current build, Tomato 200607 #2
Unigene SGN-U216328

Unigene Basic Information 
Unigene ID: SGN-U216328
Unigene Build: Lycopersicon Combined #3
Date: 2004-06-30
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 216328
mRNA sequence: Length: 2107 bp

>SGN-U216328 Lycopersicon Combined #3 (16 members)
TCGGATCTCTCTTCAGTAATAGAAATCTCATCGATCTCAGTCAACTCGTCACTGACTCACAAAATGACCAGTCGACTCATTCTTCTCCTT
TTTCTCTCTTCCCTCCTCATCTTCTCCGTCCTACTCACTCCATCACTCGCCGGCACCGGCGCCGATGACGACGACGACGAAGATCTCAGC
TTCCTCGAAGCAGACGACGTAAACGACGCCGCGCCGGAGCACACTTTCCCAACCGAAACCTTCTCTGACGACGACGACTTCGACGACGAC
GAGGACTTCGAAAATTACGACGATTTTGAAGTTCCGTCGGCGTTTGATGACGAGAAGGAAGAGGAAGGTGTTAAATTCGACGATAAAGAC
GTCGTCGTTTTGACGGATAGGAATTTCAGTGACTTTGTAGAGGATAATAAGTATGTGATGGTGGAGTTTTACGCGCCGTGGTGTGGTCAT
TGTAAGGAACTTGCACCGGAGTACGCAGCTGCAGCGACGGAGCTGAAATCGGAGAATGTGCCGCTGGTTAAAGTTGATGCTACGGTGGAG
AATGAGCTAGCGGAGAGTTATGAGGTTCAAGGATTTCCTACTATTTATTTTTTTGTTGATGGTGAGCATAAAACTTACAGTGGCCAAAGA
ACCAAAGATGCAATTGTGACTTGGATCAAGAAGAAGATTGGACCTGGCGTTTACAATATAACTACAACAGAGGACGCAGAGCGTGTACTA
ACGTCTGGAGACAAAGTCGTGTTAGGGTTCCTTGAGTCCTTGGTGGGTCCTGAAACTGATCAACTTGCTGCTGCTTCAAAACTTGAGGAT
GATCTTAACTTTTACCAGACGACAAATCCTAACGTGGCTAAGCTATTCAATGTTGAAGACACTGTTAAACGCCCAGCTTTAGTCTTGCTT
AAAAAAGAAGAGGAGAAAGTGGTGCATTATGATGGTCAATTCACCAAGTCTGCAATAGTTAAGTTTGTATCTGCCAACAAGCTTCCTCTA
GTAACAGTTTTTACTAGAGAAAGTGGAGCTTCGATTTTCTCGAGTCCTATAAAGAAGCAGGTTTTGCTCTTTGCCCGAACAAATGATACA
GATAAAGTATTCCCAACATTTCAAGAAGCTGCAAAACATTTTAAGGGAAAGCTTATCTTTGTTTTTGTCAACATGGATGATGAAGAAGTT
GGAAAGCCTGTGTCAGATTATTTTGGAGCCACCGGAGATTCTCCAAAGGTTATCGGATATACAGGAAACGAGAATCCTAGGAAATACATA
TTTGATGGGGAGATCACTGTTGAGAAGCTTAAGGCATTTGGAGAAGATTTTCTGGCTGACAAGCTCAAAGCTTTTTATAAATCAGACCCT
ATTCCTGAGGATAATGAGGGGGACGTGAAGATAGTAGTGGGGAACAATTTTGATGACATTGTTCTGGATGAGTCAAAAGATGTGCTTCTG
GAGATATATGCACCATGGTGTGGGCATTGCCAATCTCTAGAACCAACGTATAACAAGCTTGCAAAGCACTTACGTGGCATTGAGTCTCTT
GTTATAGCCAAAATGGATGGTACCACGAATAAGCACCCTCAGGGAAAGGCTGAAGGATTTCCCACACTCCTCTTCTTGCCAGCAGGGAAC
AAGACCGCGGATCCAATCCCAGTTGATTCTGACCGAACTGTAGTGGCATTGTACAAGTTTATCAAGAAACACGCAACTATTCCTTTCAAG
CTTCAAAAACCAGCTTCATCGACAACTACATCAGAGAGTCCGGAAGCCAAAGTAGGTGGCAACGTTGAGTCGAAGAATGAAAAAGATGAA
CTATGAAAGTTACATAGCTCTGTTACTTTATCTTCTCTGTTATTCTTCTAGCTAGCTTGTTTTGTAGTAGGAGTAGATAGACTGGGCTAC
GAAGATGGCCATGGAACATATTTTGTTATTTCTTTTTTGCTTTGAGTTTAAAGTTTAATGTCCTTCTATGAATGATAAGTTATATATATG
TCTTAATTTCTATATCATTAGGTTATTTTTACTTGCTGTAGTAGCAAATGTACCAAAAACATTACAAGTATGAATGTAATTTTATCTCAA
TCTAATTGAAGTTTGTGTAGAAAAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (10)  
mRNA member sequences (16)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 1 | blast: 2 | go: 6 )  
Protein prediction analysis (1)  
Gene Family (3)  
Preceding Unigenes (1)