Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.


This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been superseded by SGN-U586335 in the current build, Tomato 200607 #2
Unigene SGN-U217726

Unigene Basic Information 
Unigene ID: SGN-U217726
Unigene Build: Lycopersicon Combined #3
Date: 2004-06-30
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 217726
mRNA sequence: Length: 1081 bp

>SGN-U217726 Lycopersicon Combined #3 (11 members)
AAATTATAAAAAAAAAAAAAACATCGTAGTATATAGGTATAAATATTAGTACAAAAAAATAGTCTCTCTATGTTTTATCCCAAATAACAG
TTAAGTTTCTAATCTCTTCTTTAATTACTTTTAATTTTAATTATGTATAGTTGTTTGTGATGTGTTTATGTTATGTTTTAGGGTTGAAAA
GAACAGGTAAGAGTTGTAGGTTACGTTGGGTTAATTATTTGAATCCTGATCTCAAACATGGGAAAATGACTCCTCAAGAAGAACGTCTTG
TTCTTGAACTTCACTCCAAATGGGGAAATAGATGGTCAAGAATTGCCCGAAAAATACCAGGACGTACTGATAACGAAATTAAAAATTACT
GGAGAACTCATATGAGGAAAAAGGCCCAAGAACAGAGGAAAAAGTCTTCTGTTTCTCCATCTTCTTCTTCTTCTTCTTCAATCACTCACG
AAGAAAATGAAAGAAACTTCTACGATACGGGTGGACTCAAGCTCTTGCAAGTTGAAGGAGAAAAGAAATCTAGTGATCAAGAACAAGATG
GAAAAAGTATGAAAGTTTACTCTATGGATGAAATTTGGAAAGATATTGAATTATTAGAAGAAAATGAAGAAAAAATGAATAAACCAATTA
TGGGGTCCATTTTACCCCTATGGGATTATTCCCTAGACTCACTTTGGAAAGATTTTGATTGGAATAACTTTCGATAGGAACATGACACAA
CAGATTTCATATATCAAATGGTTAAATTGAGGATCAGAAAAGACGAATTGCTAGGAGGTTCATTTATTTGAAAAGAAAAAACAAAAACAA
AATTGTTATAGTTTGTGATAGGTTTTACAAGAAAAATATTAAGTTTTAACTTGTATATTACTATATTATTAGTGGTGAAAAAAATAAAGA
AAGATTAGAAGGTGCTAGGCCCCTCTTAAGAGGATTAGTAGTAGTGCTTTGGAATTAAGTCTCTTATTGTAGCCATTTCATGATGCTTTG
ATTTAATTTCTTTGACTTTTAAGGTTGTTTCAATGTGACATATTTTCGCTATCGAGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
A


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (5)  
mRNA member sequences (11)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (4)  
Annotations (manual: 2 | blast: 2 | go: 2 )  
Protein prediction analysis (1)  
Gene Family (3)  
Preceding Unigenes (1)