Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.


This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been split into SGN-U577291, SGN-U577305, SGN-U578505, SGN-U578708, SGN-U579099, SGN-U579405, SGN-U580431, SGN-U580483, SGN-U581176, and SGN-U592710 in the current build, Tomato 200607 #2
Unigene SGN-U218904

Unigene Basic Information 
Unigene ID: SGN-U218904
Unigene Build: Lycopersicon Combined #3
Date: 2004-06-30
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 218904
mRNA sequence: Length: 985 bp

>SGN-U218904 Lycopersicon Combined #3 (447 members)
AGCCTTCAACAATATTTAAAGTTTACCATCAAACACTTACTTTTCTCTTGATATAAACACAATGGCAGCTGCTACAATGGCTCTTTCTTC
CCCTTCTTTTGCTGGACAGGCAGTGAAACTCTCACCCTCTGCCTCAGAAATCTCTGGAAATGGAAGGATCACTATGAGAAAGGCTGTCGC
CAAGTCTGCCCCATCTAGCAGCCCATGGTATGGCCCTGACCGTGTTAAGTACTTGGGCCCATTCTCTGGTGAGTCCCCAAGCTACTTGAC
CGGTGAATTCCCTGGTGACTACGGCTGGGATACCGCTGGACTTTCAGCAGACCCTGAAACCTTTGCCAAGAACCGTGAACTTGAGGTGAT
CCACTGCAGATGGGCTATGCTTGGTGCTCTTGGATGTGTCTTCCCTGAGCTCTTGGCCCGTAACGGTGTCAAGTTCGGTGAGGCTGTGTG
GTTCAAGGCCGGATCCCAGATCTTCAGCGAGGGTGGACTTGACTACTTGGGCAACCCAAGCTTGGTCCATGCACAAAGCATCTTGGCCAT
CTGGGCTTGCCAAGTTGTGTTGATGGGAGCTGTTGAGGGATACCGTATTGCTGGTGGACCTCTTGGTGAGGTTGTCGACCCACTCTACCC
TGGTGGCAGCTTCGACCCATTAGGCCTTGCTGAAGACCCAGAGGCATTTGCTGAGCTCAAGGTAAAGGAGATCAAGAACGGTAGACTTGC
TATGTTCTCTATGTTTGGATTCTTTGTTCAAGCTATTGTCACCGGAAAGGGTCCATTGGAGAACCTTGCTGACCACCTTGCAGACCCCGT
AAACAACAATGCCTGGGCTTTCGCCACAAACTTTGTCCCCGGAAAATGAATCTCTTAAAACGTTCTCAAGTCTCTGGTCGTTTGATGACA
GTGTAAAGATGTAGTGTGCTACCTGACAATATAATGAAATTTTGTTTGTGTTTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (14)  
mRNA member sequences (447)  
Alignment image suppressed for unigene with 447 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (10)  
Annotations (manual: 7 | blast: 2 | go: 2 )  
Protein prediction analysis (1)  
Gene Family (3)  
Preceding Unigenes (3)