This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been superseded by SGN-U586310 in the current build, Tomato 200607 #2
Unigene SGN-U219244

Unigene Basic Information 
Unigene ID: SGN-U219244
Unigene Build: Lycopersicon Combined #3
Date: 2004-06-30
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 219244
mRNA sequence: Length: 1237 bp

>SGN-U219244 Lycopersicon Combined #3 (9 members)
GAATACACAGTGAGACTATTAGTATGGCCGACGATGAAGCAGAGATGTACGACGGAGCTAGGGCACAGTTCCCGTTGTCGTTTGGTAAGC
AAGCTAAATCTCAAAAATCTCTCGAACTTGTTCACAACGCTACTCGCCGGAACAACACCTCCTCCGTTACTCAAACTGCCGACGGTAAAC
TCGAGCCATCACCTTTCCCTTCTTTATCATCTTCCTCCAAATCCTGGCTTAATTCCCTCAAAAACCCTAAATCTAGTCATGAATCCAATT
CTAAGTCGAAGATTATCGGGCCGAGTCGTCCTACTGCTTGTTTGGGTTCGAGCAATGACAAGGAAGAGGAAGAGGAAGAGGAAGAGGAGG
AGGATGGTGGTATAATTGGACCACCTCGACCTGCTGTTGATGCAAAGACGGAGGAGGGTGAGGATGGTGAAATGATTGGGCCACCACGAC
CTCCGTTAGAAGAGGAGGATGGGGAGATGATTGGGCCACCTCCACCGCCATCGGGTTCAATGGGGTCAGACTCGGAGGACGATATGGAAG
AAGAAGAAGAACAAAATCAGTATAGGATACCCTTGAGTAATGAAATAGTACTAAAAGGACATACAAAGGTTGTGTCAGCTCTTACTGTGG
ACCATTCAGGATCAAGGGTTCTCTCTGGTAGTTATGACTATACTGTTCGGATGTATGATTTTCAAGGAATGAATGCTCGGTTACAGTCGT
TTAGACAGCTGGAACCATCTGAAGGGCATCAAGTTCGTAGTTTGAGCTGGAGTCCAACAGCAGACCGATTTTTATGTGTTACTGGGTCAG
CCCAAGCAAAGATCTATGATCGCGATGGACTTACACTTGGGGAATTTGTTAGAGGAGACATGTATATACGTGATCTTAAGAATACAAAAG
GTCATATATCTGGATTGACATGTGGAGAATGGCACCCTAAAACAAAGGAGACAATTTTAACTTCGTCAGAGGATGGTTCGTTGCGCCTGT
GGGATGTCAATGACTTTAAGAGTCAAAAGCAGGTTATTAAACCAAAACTTGCTCGGCCTGGGAGAGTTCCTGTAACAACATGTGCTTGGG
ATCGGGAAGGAAAAAGCATTGCAGGTGGTGTAGGAGATGGTTCTATCCAGATATGGAATCTTAAACCTGGATGGGGGAGCAGACCAGATA
TATATGTAGCAAATGCCCATTCAGATGATATTACAGGAGTCAAATTTTCAAGTGATGGGCGGATACT


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (5)  
mRNA member sequences (9)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (1)  
Annotations (manual: 1 | blast: 2 | go: 0 )  
Protein prediction analysis (1)  
Gene Family (3)  
Preceding Unigenes (1)