This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been split into SGN-U577904, SGN-U578438, SGN-U579638, SGN-U580797, SGN-U580869, SGN-U580983, SGN-U590550, SGN-U590702, SGN-U591038, SGN-U591361, SGN-U593051, and SGN-U593165 in the current build, Tomato 200607 #2
Unigene SGN-U225539

Unigene Basic Information 
Unigene ID: SGN-U225539
Unigene Build: Lycopersicon Combined #3
Date: 2004-06-30
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 225539
mRNA sequence: Length: 2689 bp

>SGN-U225539 Lycopersicon Combined #3 (983 members)
TTTTTTTTTTGATGAAGAACAAATAATTCTTTTTCACTATAAACATACAGAGATGATGAAACACAAGTAAACATAAAGCAAAAGTGAGAT
CAAAGCAGATTTTTTTTTTGGTGTAATGGTAGATTTATTTTTATTTTAGACGAATAATTTTTACAGCAACCAGGTAATGAGAAGTATCAT
AAAAGCAAGATGTACACTAGATTTCTACAGCATAGGAAAATAAAACTTCGGCACGTTTGTACCTCATGGCTGTTTAGCCAAAATCTTGGA
GGGCAACCAAGTTATAACGCGTTCCTTTAAATGACGATTCCACTTGGAATCAAAGCATCCTTGATGACAGTGACAATCCCACTCTTGATG
AAGTATCCATCTGTTTCCCTAGCCGCTTCTTGAACATTGTCTTTGTTAATGATCTTCACATTGTCCCCTATACGAGCATTCTTGTCGATA
ATGGCTCTTTTGATGTGACAATTCTTGCCGATGCCAATTGGGACACTGCCCTTTGCAGCCAGCAGCTTCCTGTCAGCATCAGTCTCGTAG
TAATCTGCCCCCATCAAAAGTGAGTCTTCTATAATTGCTCCCTCTGATATGCATGATCTGAGCCCAACCACGGAATGGTGAATCTTACAG
TTCTTGATCACACAACCTTCACCAATGACACTATCTGTGACATCGGCATCAAGCATTTTTGAAGGTGGCAAATATCGAGGTTGGGTGTAG
ATTGGGGCTGATCGGTCGTAAAAGCTAAAATCTGGCACCGGCTTTTTTGTAATGCCCAAATTGGCATTGTAGAAAGCTTCAATGGTACCA
ATATCTTCCCAGTACCCATCATATAAATAAGCTTGCACTCTCATCCCAAATGAAGTTGCACCAGGAATAACTTCACTACCAAAATCATTG
GCCCCAGGAAACTTGTCACGAAGTAGGTTTAACATCACGTCTTTGCTAATGACATATATACCCATACTGGCGATAAAAGGCATTTCTTTA
GCTCTCTTGTCATCAAGACCTAAAATGGTAGTATCCACTTTCATTGCTTGCAATTGCTCTCCTTGCGGTTTCTCTGCAAATTCAATAATG
CGTCCTTCTTCATCAATCTTCATGAGACCGAATGCAGTGGCACGCTTCTCGTCCATTGGCAGTGCGGCAACGGTAATATCAGCATCTGTT
TCCCTGTGGGCTTGAATAAACTTTTCATAATCCATTCGATACAGATGATCTCCAGCAAGTATAAGGTATTCAAGAACATTATGCTCCTCA
AACAACCACAGATATTGTCTGACAGCGTCCGCAGTGCCCTGGAACCAATCGGGGTTCTCCGGACTTTGTTGAGCAGCAAGAACTTCCACA
AAGCCCTCGTTTTTGTATCCTCCCATATTGCTAGCATATGCCCGTGAAAGGTGGCGATTTAGAGAGGCAGAGTTGAATTGTGTGAGAACA
TAGATCTTGGATATGTTACTGTTCAAGCAATTGCTTACGGGAATGTCAATCAGACGATAATTTGCTCCAAGTGGAACCGCAGGTTTTGCT
CTTTTTTTAGTTAGAGGATAAAGTCGGGTCCCAGCTCCACCTCCAAGAATAATTCCCAAAACACTCCTGCTAGCATCTGGGTCCAGACAT
GTCTGTGAATTCTGCGAATCAGAAACAGCCTTAGGAGACACAATCAATGGACTTCTTCTCACATTGAATCGTACTCCTTGGGAACGTAAG
GACGATACAGGCATCAACTTGTCTCCGGCGAGATGAGAAGACGAAAATGAGAGATTTCTGCTGGATATTGCACGTGTAGAATCATTTCTT
CTCTCATTGATGCAATTGTGGGAAGAAGGTGAAGATTTTAAGGCTCCAATGGAAGCCGCCATTGTTAACAAAGCTTGCTCTCAACTATAG
ATACTATCAAGATAAGCACTTGGTTTTCAGCAATGGCTTCTTCAGTAATGTCCTCAGCAGCTGTTGCCACCCGCGGCAATGGTGCACAAG
CTAGCATGGTTGCACCCTTCACTGGACTCAAGTCCACCGCTTCTTTCCCTGTTTCAAGGAAGCAAAACCTTGACATTACCTCCATTGCTA
GCAACGGTGGAAGAGTCAGTTGCATGCAGGTGTGGCCACCAATTAACATGAAGAAGTACGAGACTCTGTCGTACCTTCCTGATTTGTCCG
ACGAGCAATTGCTCAGCGAAATTGAGTACCTATTGAAAAATGGATGGGTTCCTTGCTTGGAATTCGAGACTGAGCACGGATTTGTGTACC
GTGAGAACCATAAGTCACCAGGATACTACGATGGCAGATACTGGACCATGTGGAAGTTGCCCATGTTCGGGTGCACTGATGCAACCCAGG
TCTTGGCTGAGGTGCAGGAGGCAAAGAAGGCTTACCCACAGGCATGGGTCCGTATCATCGGATTCGACAATGTTCGTCAAGTGCAGTGCA
TCAGTTTCATCGCTTACAAGCCCGAAGGATACTAAGTTCTAGAAAAACTAATTGCCCTATGTTTATAGGGACAGTTTGTTTGAATTCTCC
TTTGGGTTTTCCCTTGAGAAATTGTATTCATTTTCCCTTGTTTTCCATCTTTTTATTCCGTGTATGATTAATTCGAATTTCAATCAAGTT
TACAAGAACTATATTAATGATAAAAAAATCTTTACTAAAAAAAAAAAAAAAAACTCGAGGGGGGCCTTGTTTCTTTACT


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (21)  
mRNA member sequences (983)  
Alignment image suppressed for unigene with 983 aligned sequences.
[Show Image]
Markers Information (1)  
Expression Data (48)  
Annotations (manual: 8 | blast: 2 | go: 3 )  
Protein prediction analysis (1)  
Gene Family (3)  
Preceding Unigenes (4)