This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been superseded by SGN-U568116 in the current build, Tomato 200607 #2
Unigene SGN-U227716

Unigene Basic Information 
Unigene ID: SGN-U227716
Unigene Build: Lycopersicon Combined #3
Date: 2004-06-30
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 227716
mRNA sequence: Length: 810 bp

>SGN-U227716 Lycopersicon Combined #3 (3 members)
TTCTTCTCTCTATTTTCCCTCTTTATAACCCCTTCATATCCTTCCAACACAAGTGTCCATCATTAGAAGTTGCATCTCTATTCTGGGCAC
GCATCGAAAAAAGTGCTCTGCTAATGAAATTGATCCACTAATAATTATTTCAATCAAGATCGAGCACGCTTATCTCGAAAAAAAAGAGAC
ATGAGTAATAATAATATTGTGGAGAAGGCAATCAAGAGTTTAGGAAAAGGATTTGATTTAACATGTGATTTTAGACTAAAGTATTGTAAA
GGAAATGAAAGGCTTGTGTTACTAAATGAAAAATTGAAGAAAGAGTTGATGGTGCCTGGTTTTGGAGCTTATGAAAATGTACCAATTGAT
ATTAAGTGTGATAAAGGTGATAGAGTTAGATTTCAATCTGATATTCTTGATTTTAATCAGATGTCTGAATATATAAATAGGAGAAGTTCA
GTGCCTGGAAAAATACCATCTGGACTGTTTAATTCAATGTTTGGATTTGAGAGTGGTTCATGGGCTAATGATGCAGCAAATACAAAGTAT
TTGGGGCTTGATGGTTATTTCATCATATTATTTGATGTTCATATTGATAGATATTCACTTGTTTTGGATAATCAAGTTGTTAATGATGTT
CCTTCCACTTGGGATCCTGCAGCACTTGCAAGGTTTATTGAAAAATATGGTACACACATAATAGTGGGGTTAAGTATTGGAGGACAAGAT
GTGGTCCTAGTGAGGCAAGACAAATTATCAAACATGGAACCATCACAACTCAAGAACCACTTGGATGAACTTGGTGATCAATTATTCACT


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (3)  
mRNA member sequences (3)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 1 | blast: 2 | go: 0 )  
Protein prediction analysis (1)  
Gene Family (3)  
Preceding Unigenes (1)