Sol Genomics Network

This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been superseded by SGN-U598462 in the current build, Tomato 200607 #2

Unigene SGN-U237586

Unigene Basic Information

Unigene ID:	SGN-U237586
Unigene Build:	Lycopersicon Combined #3
Date:	2004-06-30
Organism:	S.lycopersicum S.habrochaites S.pennellii
Alternative ID:	237586
mRNA sequence:	Length: 175 bp

>SGN-U237586 Lycopersicon Combined #3 (1 members)
GAGAAAGGGGTTCCAGCAGTTATGAGGTGTTTTGATAGGGCAAAAATATATGTAAAAGCAGGGGATGGAGGGAATGGGGTGGTGGCATTT
AGGAGGGAGAAGTTTGTGCCATTGGGTGGACCATCTGGTGGTGATGGAGGGAGGGGAGGAAATGTGTATGTGGAGGCCAATGGGT

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum pennellii	cLPT	leaf trichomes 4-8 weeks old	2729	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E366120
[Show Image]

Markers Information (1)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 0 )

Protein prediction analysis (1)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	254	GTP1_OBG Small_GTP GTP-bindding_dom	62
2	27701	GTP1_OBG Era Cons_hypothATPbd Small_GTP ProtSyn_GTPbind GTP-bindding_dom Cons_hypoth92 ARF/SAR GTP1_OBG_sub UCR_14kDa GTP1/OBG_dom ArgK	4
5	66842	GTP1_OBG Era Cons_hypothATPbd Small_GTP ProtSyn_GTPbind GTP-bindding_dom Cons_hypoth92 ARF/SAR GTP1_OBG_sub UCR_14kDa GTP1/OBG_dom ArgK	2

Preceding Unigenes (1)

Unigene	Build
SGN-U165543	Lycopersicon Combined #2

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer