Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.


This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been superseded by SGN-U570923 in the current build, Tomato 200607 #2
Unigene SGN-U238205

Unigene Basic Information 
Unigene ID: SGN-U238205
Unigene Build: Lycopersicon Combined #3
Date: 2004-06-30
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 238205
mRNA sequence: Length: 273 bp

>SGN-U238205 Lycopersicon Combined #3 (1 members)
GCTATTTTCTTGTCCAAAATTGACCAGTGAACGCCCTTTTTGTTGGAACCAAAAAAAAATAAAAAAAATTCATCTATTTAGGTTGTAGAT
TAGCCGTTGAGCTCTCATTTTCTCAAAAATTTGCTGGTGTTTTGGTGCTTGTTGTTGGGTTGCTAGTTCTAAGATTTTTTGTTTTTGTTT
TTATTTTGACTTCACTTGAAGCAACCCCATTTGGTTGTATATCTTAAATATTTCTTCTTTTAAACTGTAATGGACTTAAATTTTTCATCT
GGG


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E298145
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 0 | go: 0 )  
Protein prediction analysis (0)  
Gene Family (0)None
Preceding Unigenes (1)