This unigene is from an out-of-date build, Lycopersicon Combined #3
It has been superseded by SGN-U589194 in the current build, Tomato 200607 #2
Unigene SGN-U240928

Unigene Basic Information 
Unigene ID: SGN-U240928
Unigene Build: Lycopersicon Combined #3
Date: 2004-06-30
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 240928
mRNA sequence: Length: 360 bp

>SGN-U240928 Lycopersicon Combined #3 (1 members)
CATAGAAATAATTTATATTCAACTGAAATAATCTCTGAAAACATTCATAATATAATTTAAATGACAAAACAATTACAATCCGAAGTAGGA
AAAGGAAAAAAATAAATAAAGAATTACAAACTTTGATATCATGCCTTCTAACTCATAACATGAGAACCCTAAGGGTTATATATGTTGAGC
TGGAGAAGAACTTAAATGAAACATGCATGTTCAACAAGAAAGATGGAAATTTAATAATATGGAGGTGGTGGTGACGGAGAAGGGAATGGC
TTCGTGTAGTAGTCATTTTTTGACAAAGCAGGCACCTTGTATTCAAGTTTAGCAACTGAGGGTACCTCTGGAATAACATTTGACACTTTC


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E545488
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 0 | go: 0 )  
Protein prediction analysis (0)  
Gene Family (0)None
Preceding Unigenes (0)None