Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.


This unigene is from an out-of-date build, Solanum tuberosum #3
It has been split into SGN-U268316 and SGN-U268317 in the current build, Solanum tuberosum #4
Unigene SGN-U243223

Unigene Basic Information 
Unigene ID: SGN-U243223
Unigene Build: Solanum tuberosum #3
Date: 2004-07-27
Organism: S.tuberosum
Alternative ID: 243223
mRNA sequence: Length: 2241 bp

>SGN-U243223 Solanum tuberosum #3 (257 members)
CTGTTGTTTACACTATAACCTAATTTCTCTCTTTGCATTTCTCTTGCTTTCATCCTTTTTTCTTAGCAATGGCCAATGGCAAGATCAAAA
TCGGAATCAACGGATTCGGTAGAATTGGTCGTTTGGTAGCTAGAGTTGCTCTGCAGAGGGATGATGTTGAACTAGTTGCAGTGAACGATC
CATTTATTTCCACTGATTACATGACATATATGTTTAAGTATGATTCAGTACATGGACAATGGAAGCACCATGAGCTTAAGGTTAAGGATG
AGAAGACCCTTCTCTTCGGTGAGAAGGCTGTTACAGTTTTTGGAATCAGGAACCCTGAAGATATCCCATGGGGGGAAGCTGGTGCTGACT
TCGTTGTTGAATCAACCGGTGTCTTCACTGACAAGGACAAGGCTGCTGCTCACTTGAAGGGTGGTGCCAAGAAGGTTGTGATCTCCGCTC
CTAGCAAAGATGCCCCCATGTTTGTTGTGGGTGTCAACGAGAATGAATACAAGCCAGAGTTGGACATTGTCTCCAACGCTAGTTGCACTA
CTAACTGCCTTGCACCTTTGGCTAAGGTCATCAATGATAGGTTTGGCATTGTGGAGGGTCTCATGACCACTGTCCACGCCATGACTGCCA
CCCAGAAAACTGTTGATGGTCCATCCATGAAGGACTGGAGAGGTGGAAGAGCTGCTTCATTCAACATCATCCCTAGCAGCACTGGAGCAG
CCAAGGCTGTTGGAAAAGTGCTCCCATCACTTAACGGCAAATTGACTGGAATGGCCTTCAGAGTACCAACTGCTGATGTTTCTGTTGTCG
ACCTTACTGTAAGACTTGAGAAAGAAGCCTCATATGAAGACATCAAGGCTGCAATCAAGGAGGAATCAGAGGGTAAATTGAAGGGTATCT
TGGGATACACTGAAGATGATGTGGTTTCCACAGACTTTGTTGGTGACAGCAGGTCAAGCATTTTCGATGCCAAGGCTGGAATTGCTTTGA
GCAAGAACTTTGTGAAACTTGTGTCATGGTATGACAACGAATCGGAATCAACGGATTCGGTAGAATTGGTCGTTTGGTTGCTAGAGTTGC
TCTGCAGAGGGATGATGTTGAACTAGTTGCAGTGAATGATCCATTTATTTCCACTGATTACATGACATATATGTTTAAATATGATTCAGT
ACATGGACAATGGAAGCACCATGAGCTTAAGGTTAAGGATGAGAAGACCCTTCTCTTCGGTGAGAAGGCTGTTACAGTTTTTGGAATCAG
GAACCCTGAAGATATCCCATGGGGGGAAGCTGGTGCTGACTTCGTCGTTGAATCAACCGGTGTCTTCACTGACAAGGACAAGGCTGCTGC
TCACTTGAAGGGTGGTGCCAAGAAGGTTGTGATCTCCGCTCCTAGCAAAGATGCCCCCATGTTTGTTGTGGGTGTCAACGAGAATGAATA
CAAGCCAGAGTTGGACATTGTCTCCAACGCTAGTTGCACTACTAACTGCCTTGCACCTTTGGCTAAGGTCATCAATGATAGGTTTGGCAT
TGTGGAGGGTCTCATGACCACTGTCCACGCCATGACTGCCACCCAGAAAACTGTTGATGGTCCATCCATGAAGGACTGGAGAGGTGGAAG
AGCTGCTTCATTCAACATCATCCCTAGCAGCACTGGAGCAGCCAAGGCTGTTGGAAAAGTGCTCCCATCACTTAACGGCAAATTGACTGG
AATGGCCTTCAGAGTACCAACTGCTGATGTTTCCGTTGTCGACCTTACTGTAAGACTTGAGAAAGAAGCCTCATATGAAGACATCAAGGC
TGCAATCAAGGAGGAATCAGAGGGTAAATTGAAGGGTATCTTGGGATACACTGAAGATGATGTGGTTTCCACAGACTTTGTTGGTGACAG
CAGGTCAAGCATTTTCGATGCCAAGGCTGGAATTGCTTTGAGCAAGAACTTTGTGAAACTTGTGTCATGGTATGACAACGAATGGGGTTA
CAGTTCCCGTGTGATTGATTTGATCTGCCATATGGCTAAGGCTTGATTGATGCTGCTGGGGAGCAAAAGACGAAATCTGTTTTAGTTTTT
GCTTGAAGTATTAGTTTTCTGGGCCGGGAGTGGTCTTTCTTGTTTATGTGTAATGGAATAACCAGAGAGGAACGGAACCCTGTTGTTATC
TTTGAGGATATCTTTTACTGTTTGACTTGTCATGAATGAATCAAACTTTACTTTTTCCAGTAAAAAAAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (14)  
mRNA member sequences (257)  
Alignment image suppressed for unigene with 257 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 1 | go: 5 )  
Protein prediction analysis (1)  
Gene Family (0)None
Preceding Unigenes (3)