This unigene is from an out-of-date build, Solanum tuberosum #3
It has been split into SGN-U268367 and SGN-U286834 in the current build, Solanum tuberosum #4
Unigene SGN-U243297

Unigene Basic Information 
Unigene ID: SGN-U243297
Unigene Build: Solanum tuberosum #3
Date: 2004-07-27
Organism: S.tuberosum
Alternative ID: 243297
mRNA sequence: Length: 1406 bp

>SGN-U243297 Solanum tuberosum #3 (30 members)
GTAGATCCGAGGAGTTTTTTTGGAAGAAGAAAAAAAAGCTGCAGTCTTTGAAAACCCTAATTCTCAAATCTTTCAGATCTTTCTTTAACA
AACTTCAAATCGTTATCAATCATGGCAGCAGAAGGTTCTCAGTTTGATGCTCGTCAATTCGATGCGAAAATGACAGAGCTGCTTGGTACT
GAACAACAGGAATTCTTCACATCATATGATGAGGTTCACGACAGTTTTGATGCCATGGGTTTGCAAGAAAATCTGCTGAGGGGCATCTAT
GCGTATGGTTTTGAGAAGCCATCTGCTATTCAGCAAAGGGGCATTGTTCCTTTTTGCAAGGGCCTTGATGTTATCCAGCAGGCACAATCT
GGTACTGGAAAGACGGCAACTTTCTGCTCTGGAATTCTCCAGCAGCTTGATTACAGTTTAGTTGAGTGTCAGGCTCTGGTTCTTGCACCA
ACCCGCGAGCTTGCACAACAGATTGAGAAGGTTATGAGAGCACTTGGTGACTACCTGGGTGTGAAGGTTCATGCTTGTGTTGGGGGTACC
AGTGTCCGTGAGGATCAGCGCATCCTTCAGAGCGGTGTTCATGTTGTGGTTGGTACTCCAGGCCGTGTCTTTGACATGTTGCGCAGGCAG
TCTCTTCGCCCCGACCACATCAAGATGTTTGTTTTGGATGAAGCTGACGAAATGCTCTCTAGAGGTTTCAAGGATCAGATTTATGATATA
TTCCAGCTTTTGCCACCAAAAATCCAAGTGGGTGTTTTCTCTGCCACTATGCCACCAGAGGCTCTTGAGATTACTAGAAAGTTCATGAAC
AAGCCTGTGAGAATTCTTGTGAAGCGTGATGAGCTCACTCTTGAAGGTATTAAGCAATTCTATGTCAACGTCGATAAGGAAGAGTGGAAG
CTCGAAACACTCTGTGATCTTTACGAGACCTTGGCCATCACCCAGAGTGTCATCTTTGTTAACACCAGGCGAAAGGTTGATTGGCTCACT
GATAAAATGCGTGGCCGTGATCACACAGTATCTGCAACTCACGGAGACATGGATCAGAACACTAGAGATATCATTATGAGGGAGTTCCGA
TCTGGCTCATCTCGTGTGCTTATCACAACCGATCTCCTTGCTCGTGGTATTGATGTCCAACAAGTCTCTCTTGTTATTAACTATGACCTG
CCAACTCAACCAGAAAACTACCTGCATCGTATTGGTCGTAGTGGACGATTTGGAAGGAAGGGTGTTGCAATCAACTTTGTTACCAAGGAT
GACGAAAGGATGCTTTTTGACATACAGAAGTTTTACAACGTCGTAATTGAGGAGCTCCCAGCCAATGTTGCTGATCTCCTTTGAGGTGAT
TTTGGCTCTGTGAGGGGAATTGTTCCTTTCCTACTGGAAAGTGTCTAATATATTTA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (12)  
mRNA member sequences (30)  
Alignment image suppressed for unigene with 30 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 1 | go: 4 )  
Protein prediction analysis (1)  
Gene Family (0)None
Preceding Unigenes (2)