This unigene is from an out-of-date build, Solanum tuberosum #3
It has been superseded by SGN-U268477 in the current build, Solanum tuberosum #4
Unigene SGN-U243319

Unigene Basic Information 
Unigene ID: SGN-U243319
Unigene Build: Solanum tuberosum #3
Date: 2004-07-27
Organism: S.tuberosum
Alternative ID: 243319
mRNA sequence: Length: 1349 bp

>SGN-U243319 Solanum tuberosum #3 (103 members)
GGACTTTGTTATGCAATTTTCTTCCCTATAAATGGCCCTCCATAGCTCAAATGAGATATCAGACAATTTAAAGAAGTACTATTAACATTT
AGAAGATTTCTTTCTTTCCCAGATTCATTGACAATGGCGGAGCTTCTCTCAAACTGGTCAAGCACATTAGAAGCAGTTCCTCCAAGTCAT
TGCATCCCAGTGCATGAAAGACCATCGGATACAGTTGAAATTGTGGACACTATTCCAGTCATTGATTTGGGAAAAGCTAATGGTGAAGAA
CGAAGTGCTGTTGTTAAAGATCTTTTGAAAGCTTTTGAAGAATATGGGTTTTTTCAGATAATCAATCATGGAGTACCCGTAGATCTAATG
GATGAAGCAATGAAAGTGTACAAAGAATTTTTCAGTCTGCCAGCAGAAGAGAAAGCAGAATATGCAAAGGATGCAGCTAATGATACAAAT
AGGGGTGCAGCTACACTGTACAGTAGCAGCGCTAAGCATTATGATTCAGAGGAGCATCGTTACTGGAGAGATGTCTTGGAACATAGCTGC
AATCTTGATGGAAAAGACAAAAAAACTTGGCCTAGTAACCCTCCAAGATATAGGGAGGTTATTGGTGCATATGGAGATGAATTGAGAAGG
GTGAGCAAAGTTATCTTGGGTCTGTTAGCTGAAGGGCTAGGTTTGGAGGCAGGGTTCTTTGACACAGAACTTGGGCAGAGAATGCTTGTG
AATCACTATCCAGCATGCCCAGATCCAAGTTTAACCTTGGGAGTTGGTGGACATTGTGATCCTAATCTCATAACCATTATCCAACAAGAA
GTGTATGGTCTTCAAATATTGAAGGATGACAAATGGATTGGTGTGCAGCCTATCCAAAATGCATTTGTGGTCAATTCTGGTTTACCAATT
ACGGTAGTTAGCAATGGAAAGCTAACTAGTGTTGCACATCGTGTGGTGACAAACACAACTCATTCACGAACCTCCATTGGTACTTTTATT
TGCCCACACGATATTGTTGAACCTGCAAAAGCACTTGTTGGTCCGGAGAATCCTCCACAGTTCAAATCCTTTAATTGGGGAATTGATTTT
ATGCCACATTACCTCAGCAAGAAATCAGTTTACCACGCATCATTGGAGCCCTTCAAAATCGATGCTTAAGCATTTGTGTGCCAGAAGGAT
CAAGTCTATGCTGCTACTTTTAATTTCCACTAAAATAAGAGCTTTAATTTACAATGTCTTTCTAGTTTGTATCCTACCTTTGTTACCTAT
TTCATGAATAAGAATCTTTCTTTCCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (10)  
mRNA member sequences (103)  
Alignment image suppressed for unigene with 103 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 1 | go: 0 )  
Protein prediction analysis (1)  
Gene Family (0)None
Preceding Unigenes (1)