Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.


This unigene is from an out-of-date build, Solanum tuberosum #3
It has been superseded by SGN-U268461 in the current build, Solanum tuberosum #4
Unigene SGN-U243438

Unigene Basic Information 
Unigene ID: SGN-U243438
Unigene Build: Solanum tuberosum #3
Date: 2004-07-27
Organism: S.tuberosum
Alternative ID: 243438
mRNA sequence: Length: 1006 bp

>SGN-U243438 Solanum tuberosum #3 (87 members)
CCTACGCATTATACTTTTTCTTCTCTCTCAAAAAAAACTCTGCCGCTCTCTCTCTTTGCTGCGAATTTTTCTTCTCATCCTTTCGACAAT
GGCTTTACCAAACCAACAAACTGTAGATTATCCAAGCTTCAAGCTTGTTATTGTGGGGGATGGAGGAACTGGGAAGACAACTTTTGTCAA
AAGGCATCTCACTGGTGAATTTGAGAAAAAATATGAACCCACTATTGGTGTGGAGGTTCATCCACTAGACTTCTTCACAAATTGTGGGAA
AATTCGCTTTTATTGCTGGGATACAGCCGGACAAGAGAAGTTTGGAGGTCTCAGAGATGGTTACTACATTCATGGGCAATGTGCAATTAT
CATGTTCGATGTTACAGCCCGTCTGACCTACAAGAATGTTCCTACTTGGCATAGAGATCTTTGCAGGGTTTGTGAAAACATCCCCATTGT
TCTCTGTGGAAACAAAGTTGATGTGAAGAACAGGCAGGTTAAGGCAAAGCAAGTTACCTTCCACAGGAAGAAAAATTTGCAATACTATGA
GATCTCAGCAAAGAGTAACTACAACTTTGAGAAGCCTTTTCTGTACCTTGCTAGAAAGCTTGCTGGGGATGGTAATCTTCACTTTGTGGA
ATCACCTGCACTTGCTCCCCCAGAAGTACAAATTGACTTAGCTGCACAGGCATTGCATGAACAGGAGCTTCAACAAGCCCTTAATCAGCC
ACTTCCAGATGACGATGATGAAGCATTTGAATAGATGGCATAGCTCAGAGCAGATCAGTTTCACTGTTGCACCTTCCCATATTCCTAGTC
CTTAAATTTTCTCTATTTGGACTTTTGTCTTTGTTGTTTGAGGATCTATTTGCTGCTTCCTTGTATTATTGATTGGTTATTAGATATGTT
CGTCTGGGGCCATGAGGCTTTGTTTTGTTAGGTTAGTTATGTCGACCCTGATGTAAGGGGCGCACATTATCGAGGCTCTGTTTTGAGCTT
TTTATAATACTACTTG


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (13)  
mRNA member sequences (87)  
Alignment image suppressed for unigene with 87 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 1 | go: 6 )  
Protein prediction analysis (1)  
Gene Family (0)None
Preceding Unigenes (2)