Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.


This unigene is from an out-of-date build, Solanum tuberosum #3
It has been split into SGN-U270047, SGN-U270048, and SGN-U287674 in the current build, Solanum tuberosum #4
Unigene SGN-U245385

Unigene Basic Information 
Unigene ID: SGN-U245385
Unigene Build: Solanum tuberosum #3
Date: 2004-07-27
Organism: S.tuberosum
Alternative ID: 245385
mRNA sequence: Length: 1238 bp

>SGN-U245385 Solanum tuberosum #3 (12 members)
TTTGCTACTGGAGGTTATGCTGCAATGCAGCGGGTCACCGAATGGAATCTTGATTTTGTGGAGAACTGTGAGCAGGGAGATAGGTATCAG
GAACTAGCTCACAGGGTTGATGAAGCCTTAGGATTCATGGCTGCTGCTGGACTCACAGTTGACCACCCTATCATGTCAACAACTGATTTC
TGGACATCCCACGAGTGCTTGCTTCTTCCTTATGAACAAGCACTTACAAGGGAGGATTCAACTTCTGGTCTTTTCTATGATTGTTCTGCT
CACATGGTATGGGTTGGGGAAAGAACCAGGCAACTAGACGGTGCTCATGTCGAGTTTTTGAGAGGAGTTGCAAACCCTCTTGGCATAAAG
GTGAGTCAAAAAATGGATCCAAATGAGCTAATTAAGCTCATTGACATCCTGAACCCTGCCAATAAGCCTGGAAGAATAACTGTAATTGTT
AGAATGGGTGCTGAGAACATGAGAGTGAAACTTTCCCACTTGGTCAGGGCAGTACGAGGAGCTGGTCAGATTGTGACATGGGTTTGTGAT
CCAATGCACGGGAATACCATCAAGGCACCATGTGGACTCAAAACCCGTGCTTTCGATTCAATCCTGGCTGAGGTCCGAGCTTTCTTCGAT
GTGCATGAGCAAGAAGGAAGCCACCCTGGTGGTATTCACCTAGAAATGACAGGGCAAAATGTGACTGAGTGCATTGGTGGATCACGAACA
GTAACCTATGACGATTTGGGCTCTCGCTACCACACTCATTGTGACCCAAGATTGAATGCTTCTCAGTCTCTTGAACTTTCCTTCATCGTA
GCTGAGAGACTAAGAAGACGAAGAATGTCCACTCAACGTCTGTAGGCTTATCTAATTACCTGTACTTTTTTAGTATGGATTCTTGTTCTC
TTGGTATCCAATAACTTATATATGTGGCCTCTGGCCATTTGAGCTGCTGTTTGGATCCAATGTTGAACATGTTACTAATAAACATGGCAG
AGCAACTTGCCTATGAGGTAAATAGATTTCCTGCAGAGATCAAAGGGGAAATGAACATCAAGTTATTAGTCGATTTATCCGGTATCTGTT
CTGTTTATTTTAGTTTGGACTGTAAGTCTAGGGTATAAGGGTGTTCTTTTTCTTTCCTTGATGTATGAATGATACTTTGAGATACTGGTT
TTGCTGTTTTAGTCTAATGTGTTTGCCCTTAAAAAAAAAAAAAAAAAAAAACTCGAGACTAGTTCTCT


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (7)  
mRNA member sequences (12)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 1 | go: 2 )  
Protein prediction analysis (1)  
Gene Family (0)None
Preceding Unigenes (1)