Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.


This unigene is from an out-of-date build, Solanum tuberosum #3
It has been superseded by SGN-U294971 in the current build, Solanum tuberosum #4
Unigene SGN-U261708

Unigene Basic Information 
Unigene ID: SGN-U261708
Unigene Build: Solanum tuberosum #3
Date: 2004-07-27
Organism: S.tuberosum
Alternative ID: 261708
mRNA sequence: Length: 659 bp

>SGN-U261708 Solanum tuberosum #3 (1 members)
ATTATTTCAAGCATAATCTTTCATCATACATACATACATTTACTTGCTCTTACTATTAATACCCATTCTTGAATTCTTAATCACCACAAT
TTTGCTATCCTTGTTTCCTTTTGGTGCATAAACAACATACTTATTGCTTGATTTTGGTGAAGGTGGCCATTGTCCACAAGCCACAGCCAT
GTCCCTTAATGGTTGAATTGCTTCTAATGTTTCAATAATGGCTGGCATTTTGGGCCTATCTTTTGGGTTCAAACTTGTGCATAGTGAAGC
TAAATGGGCCATTTCTTTTGAACCTTTTACTGAATATTGTCCACCAAATCTTGGGTCCATTATACAACGCAATCTTCTACTACTTGACAA
GTAAGGCCTGGTCCAATCCACTAAGTTTTGCTCATTTTTGGGCCTTGTTTTGTCCATTGCTCTTCTTCCTGTTAGTAGTTCTAGTAAAAC
TACTCCAAAGCTATATATGTCACTTCTTGTAGTAAGATGTCCTGTGCTAACATATTCAGGGGCTGCATATCCATAAGTGCCCATTACTCT
AGTAGTAACATGAGTGTTTGATCCTTCTGGGCCCATATGTGCAAGCCCAAAATCTGACAATTTTGCAGTAAAGTCAGAATCAAGCAATAT
GTTGGAGGTTTTGAAATCACGATAAATAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E575233
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 1 | go: 0 )  
Protein prediction analysis (1)  
Gene Family (0)None
Preceding Unigenes (0)None