Unigene SGN-U268255

Unigene Basic Information 
Unigene ID: SGN-U268255
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 268255
mRNA sequence: Length: 880 bp

>SGN-U268255 Solanum tuberosum #4 (50 members)
GTTATTCTCAAGCTCTCTCTCTCTCTCTCTGTCCTCTCGTGCTTTCTCTCACTAGATCCCTCTTTCCCAAACTGTTCTTCAGGGATCATT
AAGAAGAAAGAGAAATGGGGTTGACATTCACCAAGCTTTTCAGTCGGCTATTTGCCAAGAAGGAAATGCGCATCCTCATGGTTGGACTCG
ATGCAGCTGGTAAGACCACCATATTGTACAAGCTCAAGCTGGGAGAAATTGTCACCACCATTCCAACTATTGGTTTCAATGTGGAAACTG
TTGAATACAAGAACATCAGCTTCACCGTTTGGGATGTCGGGGGTCAGGACAAGATCCGTCCATTGTGGAGGCACTATTTCCAGAACACTC
AGGGTCTCATTTTTGTGGTTGATAGCAATGACAGAGACCGTGTAGTGGAGGCAAGAGATGAATTGCACAGGATGTTGAATGAGGATGAGC
TTCGGGATGCTGTGCTGCTTGTTTTTGCTAACAAACAAGATCTTCCTAATGCAATGAATGCTGCTGAAATAACCGATAAGCTTGGACTCC
ACTCCCTCAGGCAGCGTCACTGGTACATCCAGAGCGCTTGTGCAACTTCTGGCGAGGGACTCTACGAGGGGCTTGATTGGCTTTCTAACA
ACATTGCCAATAAGGCCTAAGTCGAAGTAGAGTTGTTGCGGATTGATCCTGGATGCAGGCGGGTTTTTATCTAGTTCCATTTTCTTTTAT
TTCGTTGTTTTTCTTCTTCTTCTTCAGACATTCTCTGAATCTGTGTGGTTATGGCATTTGCTTCTTAGGAGGTCACTTTTGAAATGTTTT
TGTAATACAATGTTTGAATGTATGTAATTTGCGGATTGTTTAGGTTCGAGTATAAACGTTATTAACTTGT


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (19)  
mRNA member sequences (50)  
Alignment image suppressed for unigene with 50 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 7 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)