Unigene SGN-U268332

Unigene Basic Information 
Unigene ID: SGN-U268332
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 268332
mRNA sequence: Length: 2482 bp

>SGN-U268332 Solanum tuberosum #4 (130 members)
GGTAACTTTTACTCATCTCCTCCAATTATTTCTGATTTCATGCATGTTTACATTCTATTATGTATTATGAATCATAGTTTCGTGTATAAA
CGTTGTTTCATATCTCATCTCATCTATTCTGATTTTGATTCTCTTGCCTACTGAATTTGACCCTACTGTAATCGGTGATAAATGTGAATG
CTTCTTCTTCTTCTCAGAAATCAATTTCTGTTTTGTTTTTGTTCACTGCTCAACAAGTGCTCTGGTAGATTCCCCTTTTTGTAGACCACA
CATCACATGGCAAGCATCACAGCTTCACACCACTTTGTGTCAAGAAGCCAAACTTCACTAGACACCAAATCAACCTTGTCACAGATAGGA
CTCAGGAACCATACTCTGACTCACAATGGTTTAAGGGCTGTTAACAAGCTTGATGGGCTCCAATCAACAACTAATACTAAGGTAACACCC
AAGATGGCATCCAGAACTGAGACCAAGAGACCTGGATGCTCAGCTACCATTGTTTGTGGAAAGGGAATGAACTTGATCTTTGTGGGTACT
GAGGTTGGTCCTTGGAGCAAAACTGGTGGACTAGGTGATGTTCTTGGTGGACTACCACCAGCCCTTGCAGCCCGCGGACATCGGGTAATG
ACAATATCCCCCCGTTATGACCAATACAAAGATGCTTGGGATACTAGCGTTGCGGTTGAGGTCAAAGTTGGAGACAGCATTGAAATTGTT
CGTTTCTTTCACTGCTATAAACGTGGGGTTGATCGTGTTTTTGTTGACCACCCAATGTTCTTGGAGAAAGTTTGGGGCAAAACTGGTTCA
AAAATCTATGGCCCCAAAGCTGGACTAGATTATCTGGACAATGAACTTAGGTTCAGCTTGTTGTGTCAAGCAGCCCTAGAGGCACCTAAA
GTTTTGAATTTGAACAGTAGCAACTACTTCTCAGGACCATATGGAGAGGATGTTCTCTTCATTGCCAATGATTGGCACACAGCTCTCATT
CCTTGCTACTTGAAGTCAATGTACCAGTCCAGAGGAATCTATTTGAATGCCAAGGTCGCTTTCTGCATCCATAACATTGCCTACCAAGGC
CGATTTTCTTTCTCTGACTTCCCTCTTCTCAATCTTCCTGATGAATTCAGGGGTTCTTTTGATTTCATTGATGGATATGAGAAGCCTGTT
AAGGGTAGGAAAATCAACTGGATGAAGGCTGGGATATTAGAATCACATAGGGTGGTTACAGTGAGCCCATACTATGCCCAAGAACTTGTC
TCTGCTGTTGACAAGGGTGTTGAATTGGACAGTGTCCTTCGTAAGACTTGCATAACTGGGATTGTGAATGGCATGGATACACAAGAGTGG
AACCCAGCGACTGACAAATACACAGATGTCAAATACGATATAACCACTGTCATGGACGCAAAACCTTTACTAAAGGAGGCTCTTCAAGCA
GCAGTTGGCTTGCCTGTTGACAAGAAGATCCCTTTGATTGGCTTCATCGGCAGACTTGAGGAGCAGAAAGGTTCAGATATTCTTGTTGCT
GCAATTCACAAGTTCATCGGATTGGATGTTCAAATTGTAGTCCTTGGAACTGGCAAAAAGGAGTTTGAGCAGGAGATTGAACAGCTCGAA
GTGTTGTACCCTAACAAAGCTAAAGGAGTGGCAAAATTCAATGTCCCTTTGGCTCACATGATCACTGCTGGTGCTGATTTTATGTTGGTT
CCAAGCAGATTTGAACCTTGTGGTCTCATTCAGTTACATGCTATGCGATATGGAACAGTGCCAATCTGTGCATCGACTGGTGGACTTGTT
GACACTGTGAAAGAAGGCTATACTGGATTCCATATGGGAGCCTTCAATGTTGAATGCGATGTTGTTGACCCAGCTGATGTGCTTAAGATA
GTAACAACAGTTGCTAGAGCTCTTGCAGTCTATGGCACCCTCGCATTTGCTGAGATGATAAAAAATTGCATGTCAGAGGAACTCTCCTGG
AAGGAACCTGCCAAGAAATGGGAGACATTGCTATTGGGCTTAGGAGCTTCTGGCAGTGAACCCGGTGTTGAAGGGGAAGAAATCGCTCCA
CTTGCCAAGGAAAATGTAGCCACTCCCTAAATGAGCTTTGGTTATCCTTGTTTCAACAATAAGATCATTAAGCAAACGTATTTACTAGCG
AACTATGTAGAACCCTATTATGGGGTCTCAATCATCTACAAAATGATTGGTTTTTGCTGGGGAGCAGCAGCATATTAGGCTGTAAAATCC
TGGTTAATGATTTTGTAGGTAAGGGCTATTTAAGGTTGTGTGGATCAAAGTCAATAGAAAATAGTTATTACTAACGTTTGCAACTAAATA
CTTAGTAATGTAGCATAAATAATACTAGTAGCTAATATATATGCGTGAATTTGTTGTACCTTTTCAAAAAAAATTATTTGCAGTACATAT
ATAATGAAAATTACCCAAGGAAAAAAAAAAAAAAAAAAAAAAAAAAACTTCG


[Blast] [AA Translation]
Associated Loci (2)  
Locus symbolLocus nameGene activity
waxy granule-bound starch synthase granule-bound starch synthase
gbss1 granule bound starch synthase 1
Genomic locations (0)None
Library representation (16)  
mRNA member sequences (130)  
Alignment image suppressed for unigene with 130 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 1 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)