Notice: The contact form functionality has been restored. Apologies for any inconvenience.

Unigene SGN-U268383

Unigene Basic Information 
Unigene ID: SGN-U268383
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 268383
mRNA sequence: Length: 3253 bp

>SGN-U268383 Solanum tuberosum #4 (239 members)
CTTTCCTCCATACTCAAACAACGCCAACAAACTCTTCTTCTCGCCGCGCTTTATCATCGTTCAATTTTGACTAAATTAAGCGATAGAAGA
TGTTTGGGAGGGCACCGAAGAAGAGCGACAACACGAAGTACTATGAGATCTTAGGTGTCCCTAAGACTGCTGCACCGGAAGATCTCAAGA
AAGCTTACCGTAAAGCTGCTATTAAGAATCATCCTGATAAGGGAGGTGATCCTGAAAAGTTTAAAGAGCTTGCACAAGCTTATGAGGTTC
TGAGTGATCCCGAGAAGCGTGAGATATATGATCAGTATGGAGAAGATGCTCTCAAGGAAGGAATGGGCGGTGGAGGTGGTGGACACGACC
CATTTGACATTTTCTCATCTTTCTTTGGTGGCAGCCCATTTGGTGGAGGTGGTGGAAGCAGCAGAGGAAGAAGACAAAGAAGAGGAGAGG
ATGTTGTCCACCCTCTCAAAGTTTCTCTGGAGGATCTGTACAATGGAACATCAAAGAAGCTGTCACTATCTCGCAATGTATTGTGCCCGA
AGTGCAAGGGGAAAGGATCTAAATCAGGTGCTTCAATGAAGTGTTCTGGCTGTCAAGGGTCTGGGATGAAAGTCACTATTAGACAACTTG
GCCCATCCATGATCCAGCAGATGCAGCACCCTTGCAACGAGTGTAAGGGTACTGGTGAGATGATCAATGATAAAGATAGGTGTGGGCAGT
GTAAAGGTGAGAAGGTTGTGCAGGAGAAGAAGGTGTTGGAAGTTGTTGTCGAGAAGGGTATGCAGAACGGACAGAAGATAACATTCCCGG
GCGAAGCTGATGAAGCACCTGATACCGTCACTGGGGACATAGTTTTTGTCTTGCAACAGAAGGAACATCCCAAGTTTAAGCGAAAGGGAG
ATGATCTCTTTGTAGAGCACACCTTGAGCTTAACCGAGGCCCTGTGTGGTTTCCAGTTCATCTTGACTCACCTAGATAATAGGCAGCTGA
TCATCAAGCCCCAACCCGGAGAAGTTGTCAAGCCTGATCAATTTAAAGCCATAAATGATGAAGGAATGCCTATGTACCAAAGGCCATTTA
TGAGAGGAAAACTATACATTCACTTTACTGTAGAATTCCCCGACACATTATCCCCCGAGCAATGCAAGAACCTTGAAGCAGTATTGCCAC
CAAAACCGAAAACACAAATGACTGATATGGAATTGGACGAGTGCGAGGAGACCACCTTACATGATGTTAACATCGAAGAGGAGATGCGGA
GGAAGCAGCAACAGGCCCAAGAGGCATATGACGAAGATGATGAAGACATGCATGGAGGTGCACAGAGAGTTCAGTGTGCACAACAGTAAT
TTGGTAACACGGAAGTTGCACTAAAGAATTAACGTCACGATTCAACTCTTGTTTTCACGTATTTGTATGACAAGATAATGACATTGTCTG
AAGAAATATTTCCTCTGCCGTAAGATATATTATAGTTTACTAGCTTATAATTTCAAGTTTTGGATTTGCTAACTGATACTGTTAAGCAAA
TTTTAATGTTACAAACATATTATTGCAATATGCTTTGATTGATATTGTATCGAAGAATTGATATAAAGAGGAAAAAAAAAAAAAAAAAAA
AAAATTAACCCAATTTTGAGAGAAAGAAAAATCATATAATGGCTTCTGAATTGATCTACCGCGGACCGGAATCACTTCCGGTTCCCGACA
GTTACACTCCCAAACCACACAAACCATGGTTTACTGTAATTCGTCCCCTTCGTTACTTGCTACGAGAACAGAGAATCGTTTTTCTATTCG
CAGGCATTGCTATCGCTTCTCTAATTTTTGCCTTTTTACCTTCTTCTCGTTCCGGAGGATCGAACTACGCAAACACCGGGATCTACGATT
CGTACTTACCGTCGGAGTCGACTCAGTCTCAGGTGGCTCACCGGATTATCTATCAGAATCGGGTCGGGTTCGGGTCGTTTAATTCCGGTG
GGAAGATCCCGTTGGGATTGCAGCGGAAGAGTTTGAGGATCGTGGTGACTGGTGGTGCTGGTTTTGTAGGTAGTCATCTTGTGGACCGTT
TGATTGCGAGAGGTGATAGCGTGATCGTCGTTGATAATTTCTTTACCGGACGGAAAGAGAATGTTATGCATCATTTTGGTAACCCTAGGT
TTGAGCTTATTAGACACGATGTTGTTGAGCCACTTTTGCTTGAAGTTGACCAGATCTATCATCTCGCTTGCCCTGCTTCTCCCGTTCATT
ACAAGCATAATCCCGTCAAGACTATTAAGACTAATGTGGTGGGGACTTTGAACATGCTGGGATTGGCTAAAAGAGTCGGTGCGAGGTTTT
TGCTGACGAGCACCAGCGAGGTGTACGGTGATCCTTTAGAACATCCACAGAAGGAGACATACTGGGGCAATGTTAATCCTATTGGTGTCC
GAAGTTGCTACGATGAGGGAAAACGTACAGCTGAAACATTGACCATGGATTATCACAGAGGTGCTGAAGTTGAGGTGAGAATTGCTAGGA
TCTTTAACACTTATGGACCTCGTATGTGCATTGATGATGGTCGCGTTGTCAGCAACTTTGTCGCTCAGGCTTTAAGGAAGGAGCCTTTGA
CAGTTTATGGTGATGGGAAACAAACAAGAAGTTTCCAATTTGTTTCAGATCTGGTTGAAGGCCTAATGCGGTTGATGGAAGGAGAACATG
TCGGACCCTTCAACCTCGGAAACCCTGGTGAATTCACAATGCTTGAACTTGCTAAGGTGGTCCAGGAAACCATTGACCCAAATGCACAGA
TTGTACACAAACCAAACACAGAAGATGACCCACACAAGAGGAAACCTGATATCTCAAAGGCTAAAGAGTTACTTGGTTGGGAACCAAAAG
TGGCTCTTAGAAATGGTCTACCTATGATGGTTCAAGACTTTAGGCAACGTATTTTCGGTGATCACAAAGAAGACAGTGGAAAGATCACCA
CAGCTTAATAGAAGAGAAGGTGTGTATGTTTGGATATTGTTAAACTTGGTCAGGGGTGAAATGCACGCGACGAAAAGATGACTCTTGTGT
TCATGTAGTTTCAAGCAGAAGTGCAGGCAGCAGAAGACTGAGCTGAGCTCCCCATGTAGTTCTTTTGAATAGTCTTAATAGTTGGTTCTT
TGTCAATTTTGTAATTCTATTATTATCCTTTTGTTAACAGTTGATGTAGTCGACCAACTTTCATTATTATCATAAGAATAAAACTGGAAC
GTTTTTCCCCAAA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
dnaj DnaJ
Genomic locations (0)None
Library representation (23)  
mRNA member sequences (239)  
Alignment image suppressed for unigene with 239 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 7 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (3)