Unigene SGN-U268409

Unigene Basic Information 
Unigene ID: SGN-U268409
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 268409
mRNA sequence: Length: 531 bp

>SGN-U268409 Solanum tuberosum #4 (7 members)
TACAACTATAAGAAAATGGAGGCAAAGTTTGCTCACATCATTGTTTTCTTTCTTCTTGCAACTTCCTTTGAAACTTTCAATGCGCAAAGT
GAAGGGCTAGAATTCATCAAACTTCTAAAGGAATTGAAATCTGTTCATGAGTCCAAGCCCAACTTGGAATGCCAAGGAAAACTAAGATGG
CCAGAACTTATTGGTGTACCAGCACAGTATGCTAAGGGAATAATTGAGAAGGAAAATACATTTATAACTGATGTTCAGATAATACTGAAT
GGTTCTCCAGTCACAGCTGATTTAAGGTGTAATCGAGTTCGTATTGTTGTAAACATCTTGGATTATGCTGTATCAATGCCTGTGGTTGGT
TAATTAATGGATTATTGAAGTAATTAAGCAAGCCACATGTGAAAATAATAATAATTAGGGTTCATGTATGTTGATTATAATGTATCCATG
TACTCTTACTATATATAATGAAATAAATAAGTGTGGCTTCATTAAAAAAAAAAAAAAAAAAAACTCGAGACTAGTTCTCTC


[Blast] [AA Translation]
Associated Loci (4)  
Locus symbolLocus nameGene activity
pin1 serine protease inhibitorprotease inhibitor
PPI3A4 proteinase inhibitor 1 3Aproteinase inhibitor
Z14027 Z14027 proteinase inhibitor 1proteinase inhibitor
Z12819 truncated proteinase inhibitor 1proteinase inhibitor
Genomic locations (0)None
Library representation (3)  
mRNA member sequences (7)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 2 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)