Sol Genomics Network

Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Unigene SGN-U268468

Unigene Basic Information

Unigene ID:	SGN-U268468
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	268468
mRNA sequence:	Length: 897 bp

>SGN-U268468 Solanum tuberosum #4 (36 members)
CTTTGGCGAGAATAGCTGAGTAGGAGCAGAGAGTTTCGCCGCACTACAATGGGCGCCTACACTTACGTGTCAGAGCTATGGAGGAAGAAG
CAGTCCGATGTGATGAGGTTCTTACAAAGGGTGAGGTGCTGGGAGTATCGCCAGCTTCCATCAATAGTGCGTGTTACTAGGCCTACTCGT
CCTGACAAGGCACGACGTTTGGGTTACAAAGCCAAACAGGGCTATGTGGTTTACCGTGTTCGTGTGAAGCGTGGTGGAAGGAAGAGGCCT
GTATCCAAGGGTATTGTGTATGGTAAGCCTACCAACCAGGGAGTCACCCAATTGAAGTTTCAGCGTAGTAAGCGATCTGTTGCTGAGGAG
CGTGCTGGTAGGAAATTGGGTGGTCTTAAGGTCCTCAATTCTTACTGGATCAATGAGGATTCAACATATAAATACTTTGAAGTGATCCTG
ATTGATTCAGCCCATGCTGCTATAAGGAATGACCCAAGAATCAACTGGATCTGCAACCCAGTGCACAAGCATAGAGAGCTTCGTGGACTG
ACTTCAGCTGGGAAGAAATACAGGGGTCTCCGAGGAAGAGGACACTTGCACCACAAGGCAAGACCCTCAAGAAGGGCAACCTGGAAGAGG
AACCAGACTCTGTCTCTACGCCGTTATCGTTGATCTGCTTAGAGTTTTTCAAGAGTTTCTTATTGTATTGTTCACGACTGTAGTCCTTTC
TTTTTTGAAATCAAGTTCTGAGAAACTTTCTTTTTTGAAATCAAGTTCTGAGAAACTTGGTAGAACAGCTCAATTTGTGCAATGGATGAT
AGATGATAATGCTAAACTGTTAAATTTATTTGGTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (14)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	ACDA	Tubers	5977	1
Solanum tuberosum	ACDC	Sprouting Tubers	5177	2
Solanum tuberosum	IVROOT	Root	5850	1
Solanum tuberosum	MXFL	Floral buds	6603	1
Solanum tuberosum	PPC	leaf 6 week old	5062	1
Solanum tuberosum	PPI	leaf 6-week old leaf	5434	1
Solanum tuberosum	SLMW	Assorted Stolon/Tuber Developmental Series	1368	1
Solanum tuberosum	STM	mixed tissues	14805	4
Solanum tuberosum	STOL	Stolon	6462	1
Solanum tuberosum	SWST	Stolon	5942	4
Solanum tuberosum	cSTA	Axillary buds of stemp explants; swelling stolons; growing stolons; growing sink-tubers 1 to 3 days (plates 1-20), 4 to 6 days (plates 21-40), 7 to 10 days (plates 41-60)	10537	9
Solanum tuberosum	cSTB	leaves and petioles 8 weeks old plants	10327	2
Solanum tuberosum	cSTE	periderm and subperiderm 24 and 48 hour, and 5 and 7 day	5425	3
Solanum tuberosum	cSTS	sprouting eyes from tubers 12-14 weeks post harvest	9230	5

mRNA member sequences (36)

Alignment image suppressed for unigene with 36 aligned sequences.
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 3 | go: 4 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	856	Ribosomal_L15e	22
2	22763	Ribosomal_L15e	20
5	56908	Ribosomal_L15e	20
1.1	102178	Ribosomal protein L15e - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Ribosomal L23 and L15e core	20
2	119143	Ribosomal protein L15e - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Ribosomal L23 and L15e core	20
5	129493	Ribosomal protein L15e - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Ribosomal L23 and L15e core	20

Preceding Unigenes (1)

Unigene	Build
SGN-U243414	Solanum tuberosum #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer