Unigene SGN-U268506

Unigene Basic Information 
Unigene ID: SGN-U268506
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 268506
mRNA sequence: Length: 1158 bp

>SGN-U268506 Solanum tuberosum #4 (285 members)
ATTGCTTCTCTCAATGGATCACAACACTCCGCAGGGGGACTCGATGCGTTAAGGTAAGGCGCACATGGCACTAATTTCGAGGCACACGAC
GGCGGCGTTGTTTGCGCATCTGACGCAATTATCGCCGCCGTCAACGCCATCGAAATTAAAACAAACATTTTTGAAGAAAACATCCTTGCT
TTTTTTTCTGTTGTCACTAGTAACTTAATTTGGTTGTTTCCTCGTGCCGAATTCGGCACTTACAAACCTTTTGCCCCTTCCATTTCTTCA
TTTATTTTCCTCTTTCCCATTTTCTTATTTTTCAACTTTATTCCAATGGCCAGTGTTGAGGTTGAATCTGCACCAGTAGCAGCAGTAGAG
ACTACTCCAGCTGAGGTTGAGGCTACCCCAGCTCCAGAGGTAACCAAGGTGGAGGAACCAGCCCCAGTTGTAGAAAAGGAAGTCGAGGTC
GAATCAGCACCAGCACCAGTAGAAGAAGAGGCTGCTCCTGTTGCGGAGGAAGCAGCAGCCCTTGTAGCTGAAGAGCCTGCAGCTGCAGAA
CCTGCAGCCGCAGTGGCAGCTGCAGTAGAACCTGTTGCAGCCCCAGTTGAGGAACCTGCGGCTGCAGAAGAACCTGCAGCCGCAGCTGAG
GAACCGGTGGCTGCAGCACCCGTTGAGGAGGCTGCAGCACCCGAAGCTGAACCAGAAGCAGCCCCAGTTGCGGAACCGGAAGCAGAGAAA
GCAGAGGAAGCTGCCCCTGTATCTGAGGAACCAGAGAAAGTTGAAGAGTAAATTCAATGGTTGATGAATGATGGTTTTTTTTTATTATTG
AAGTTTGGTTGTGTTTATTTTGCTTCTTAGTTGAGTATTTTATTTACTACTATTATTACTATATTTTAATATAATATGGTTACAATGAGG
GCATATGTTAGTATTAACATATGTCTAGGTCTAGGTGGTCGGGTGGGATATTTTACATAGTTTTTTTAAAGCTATGTTTGTTATCTTGTC
CAGGGTTCAGTTTGTCATGGTTTGATTAAAGATGATATGAGATTTGATCTCTAGTTATGATAATAATAATAAAGGGGTAATATCTTTTTT
GTTGTTAAAAAAAAAAAAAAAAAATGGTTTAATATCGGAGACAACCTCGCAAAAAATTATCTAAAAAACCTCGTGCCG


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
Z11679 Z11679 induced stolon tip protein
Genomic locations (0)None
Library representation (22)  
mRNA member sequences (285)  
Alignment image suppressed for unigene with 285 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 0 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (2)