Unigene SGN-U268593

Unigene Basic Information 
Unigene ID: SGN-U268593
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 268593
mRNA sequence: Length: 1159 bp

>SGN-U268593 Solanum tuberosum #4 (78 members)
TTTCATTTCGTGCCGTACACTCTGCTCGTGCCATTTGGTTTAACCTTTTGCATTTCCATTTCTGCTTCTTCAGAACAATTACTATGGGTA
AGTGCTATCCCACTGTGAGCGAGGAGTACCTCAAGGCTGTTGACAAATGTAAAAGGAAACTCAGAGGACTCATTGCTGAGAAGAATTGTG
CTCCTCTTATGCTCCGTCTTGCATGGCACTCTGCTGGTACCTATGATGTGTGTTCCAAGACTGGTGGTCCCTTTGGTACCATGAGGTTCA
AAGCTGAGCAAGCACATGGTGCAAACAATGGTCTTGACATTGCTCTCAGACTCTTGGAGCCCATTAGGGAGCAGTTTCCCACCATCTCCT
ATGCTGATTTCTATCAATTGGCTGGTGTCGTTGCTGTTGAAGTTACTGGAGGACCTGATGTTCCCTTTCACCCTGGCAGAGAGGACAAGC
CAGAACCACCAGTTGAAGGTCGCTTGCCGGATGCCACCAAGGGCTCTGACCACTTGAGAGACGTGTTCAAGAAACAAATGGGTCTTTCCG
ACAAGGATATTGTTGCACTCTCTGGTGGCCATACCTTGGGAAGGTGCCACAAGGAGCGTTCTGGTTTTGAGGGACCTTGGACCGCCAATC
CTCTTATCTTTGACAATTCATACTTCACGGAGCTTTTGAGTGGGGAAAAAGAAGGGCTCTTACAGTTGCCATCAGACAAGGCTCTCCTCT
GTGACCCTGCTTTCCGTCCCCTTGTTGAGAAATATGCTGCGGATGAAGATGCCTTCTTTGCTGACTATGCTGAGGCTCACTTGAAGCTTT
CTGAATTGGGATTTGCTGAAGCTTAAGATGGTGATCGGAAGAGCTGGGAGTGGTGGCATGTTTTTGTTAATGGTTCATTTCTGAAAAGCT
CGCTGGAGCTGTTGTGTTTTGCTGCTCTTTATATCATGATTTAAATTTGGCAGCTACATTAGACGATGATATTGTGACACACTCTTCCAG
CTTATTAATAAGTTTCTAGTATTTTGTTTTTGTGGTTAAAAAAAAAAAAAAATTTGTTAATTTTAAATTAATTACTTAGCTGAACTTGGT
ACGTTAAAAAAAAAAATGCTCGATGTTTATTATAATATGATAAAAATTGGTATAGAGATTGGACTGAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (2)  
Locus symbolLocus nameGene activity
apx ascorbate peroxidaseascorbate peroxidase
AY742959 cytosolic ascorbate peroxidasecytosolic ascorbate peroxidase
Genomic locations (0)None
Library representation (20)  
mRNA member sequences (78)  
Alignment image suppressed for unigene with 78 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 2 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (2)