Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Unigene SGN-U268631

Unigene Basic Information 
Unigene ID: SGN-U268631
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 268631
mRNA sequence: Length: 1101 bp

>SGN-U268631 Solanum tuberosum #4 (41 members)
GTGAAACCCTAAAAGCAGAGGAAGCTAAGGGAGAGTAACAGAGCACAACAATGGCGGCAATCACACAGCAACCAAGGACATTGACGACGA
AAGAGGCTGACATACAGCTGATGTTGGCAGCTGAAGTCCACCTCGGTACTAAGAACTGTGACTTCCAAATGGAACGTTACGTCTTCAAGC
GTCGCAACGACGGTATCTACATTATTAACGCTGGAAAGACATGGGATAAGCTGCATATGGCAGCTAGAGTTATTGTTTCTATTGAGAATC
CTCAGGACATCATTGTGCAATCTGCCAGGCCCTATGGACAGAGAGCCGTCTTGAAGTTCGCACAATATACTGGTGCACATGCCATTGCTG
GCCGTCACACCCCTGGTACCTTTACCAATCAGCTTCAGACTTCATACAGCGAGCCACGACTTCTCATTCTCACTGACCCTAGAACTGATC
ACCAGCCTATCAAGGAAGCTGCACTTGGAAACATCCCCACTATTGCCTTCTGTGACACTGATTCACCAATGCGTTATGTTGACATTGGTA
TCCCTGCCAATAACAAAGGGAAGCACAGTATTGGTGTTCTCTTTTGGATCTTAGCAAGGATGGTACTGCAGATGCGCGGTACTATTAGCG
CAGGACCCAAGTGGGATGTCATGGTGGATCTCTTCTTTTACAGAGAGCCTGAAGAGGCAAAAGATCAACAAGAAGAGGAAGTACCTGCTA
TTGCTGATTATGCAGAATATGGTGGTGCTGCTCTTGGTGGTGACTGGACTAGCAGCCAAATCCCTGATGCTCAATGGGCTGCAGATGGTG
CAACATCTGTTCCTGTAGCTACCAGTGGCTGGTCTGGAGAAGCAGTGGCTGACGGAGGATGGGATGCTGCAGCTCCTCCTCCTGCACCAG
TTGGTGTACCAGAAGTGACCACTACCCCAGCACCTGGCTTGGAATGAACTTGACTCCTTTAGAAAGTTCTTTTTGGTTAAAATTAGATAT
GTGAGTTCTTATAACAGACGGTTTTGTTTACGATGCAATTTTATTAAAATTTTGGACCTGTTGATGTACGAAATTATTTCAAATCATTTA
TAGCATGTCTTTTTAGTGCAA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
DQ207864 ribosome-associated protein p40
Genomic locations (0)None
Library representation (14)  
mRNA member sequences (41)  
Alignment image suppressed for unigene with 41 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 5 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (3)