Unigene SGN-U268842

Unigene Basic Information 
Unigene ID: SGN-U268842
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 268842
mRNA sequence: Length: 1546 bp

>SGN-U268842 Solanum tuberosum #4 (32 members)
ACAGGGATCTATACGTTTCTTGGTCCTCAAGTCGAGAGGTCACTCGGATATCAGAAATCAGTTCAGATCTTTGAGCTTAAGCGCCATGGC
GACCGAAGAAGACGCCGTCCGACGCCGTACTGCACTGGCCGATTATCGGAAAAAGCTCCTTCAGCACAAGGAGCTTGATGCTCGGGTTCG
GACAGTGAGAGAGAACTTGCGGGCTACCAAAAAGGAATATGCTAAAACAGAAGATGATTTGAAGTCACTTCAGAGTGTTGGACAGATCAT
AGGAGAAGTGCTCCGACCTCTAGATAATGAGCGTTTGATAGTAAAAGCTAGCAGCGGTCCGAGGTATGTGGTTGGCTGTCGCAGTAAAGT
TGACAAGGAAAAACTGACTTCAGGCACACGAGTGGTTCTCGATATGACAACACTTACAATCATGCGGGCACTCCCCCGTGAAGTTGATCC
TGTTGTATACAACATGCTTCATGAAGATCCTGGCAACATCAGTTACTCTGCCGTGGGTGGACTGTCAGATCAGATCAGGGAGCTGAGAGA
ATCCATTGAGTTACCTCTAATGAACCCTGAGCTTTTCCTCCGGGTTGGGATTAAGCCTCCAAAGGGTGTTCTTCTCTACGGGCCACCTGG
AACAGGCAAGACATTGTTAGCCAGGGCAATCGCTAGCAACATAGATGCCAATTTCTTAAAGGTTGTATCAAGTGCCATTATTGATAAGTA
CATTGGTGAGAGTGCAAGATTAATTCGGGAAATGTTTAACTATGCTCGTGATCACCAACCCTGCATCATATTCATGGATGAGATAGATGC
AATTGGTGGACGTCGTTTTAGTGAGGGAACCAGTGCAGACCGTGAAATCCAAAGAACGCTCATGGAGTTGCTCAATCAGTTGGATGGATT
TGACCAGCTTGGAAAGGTAAAAATGATTATGGCAACAAATAGACCTGATGTTTTGGACCCAGCTCTTCTTCGTCCTGGTCGATTAGATAG
AAAGATAGAAATACCCTTGCCTAATGAACAATCAAGAATGGAAATCCTCAAGATCCATGCTGCTGGGATTGCCAAACATGGTGAAATTGA
TTATGAGGCTGCTATTAAGCTCGCTGAGGGATTTAATGGGGCTGATATGCGGAATGTTTGCACTGAAGCCGGTATGTTTGCAATTCGTGC
AGAGCGTGATTATGTCATCCATGAGGATTTCATGAAGGCTGTAAGGAAACTGAATGAAGCAAAGAAACTTGAATCAAGTGCTCACTACAG
TGCTGATTTTGGTAAGGAATAAGCATGTGGGTGAATGCCATGGACCAATTTCAATGGTATGATAGCGCCGGATGCGGTCTTTGGTTTGCT
GTACCATTTGAGTTTGTTTATTCTGTATTTTAAATTATGTAATGCAGAATCCTCTTTCTCTGAAAGCAGCTGCATTTATTGTGTTTTCAT
TCTCATGATGTTTGTTGAAGGATTGGTAGAATAGAATACGGTGGATGTTTATTTACTGTTTTTTCGTTGCTATGTACTGAATTCTGATTG
GGCATTAGGCCCAAAA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
rpt4a 26S proteasome AAA-ATPase subunit RPT4a
Genomic locations (0)None
Library representation (18)  
mRNA member sequences (32)  
Alignment image suppressed for unigene with 32 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 7 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)