Unigene SGN-U269085

Unigene Basic Information 
Unigene ID: SGN-U269085
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 269085
mRNA sequence: Length: 979 bp

>SGN-U269085 Solanum tuberosum #4 (44 members)
TCAATATTCAAACTTTCACTTTACCTTAAAGTTGTTGATAATTTCTTTGATTGAAAAAAAGAAGAAGAAATATGGCTGATCAGTACGAAC
AGAACAAGCCATCAGTTGAAGAGACTGTTGGTGCCAACGTGGAGGCTACTGATCGTGGTTTGTTTGATTTCATTGGGAAAAAAAAAGAGG
AAAAACCAAGTCATGCTCATGAAGAAGAGGCAATTTCATCTGAGTTTTGTGAGAAAGTTAAAGTAAGTGAAGAAGAACACAAGGAGGAGG
AAAAGAAAGAAGAGAAGAAACTTCATCGATCAAGTAGCAGCTCTAGTAGCTCGAGTGACGAGGAGGAAGAAATTGGAGAGGATGGACAGA
TAATCAAGAAGAAGAAAAAGAAGGGATTGAAGGAAAAGATTAAGGAAAAAATATCTGGTGATCACAAGGAAGAAGTGAAAACAGAGGATA
CCTCAGTTCCAGTTGAGAAATACGAGGAAACAGAGGAGAAAAAAGGATTTCTAGACAAAATTAAGGAGAAATTGCCAGGTGGCGGACATA
AGAAGACGGAGGAAGTAGCGGCGCCGCCACCACCACCACCGGCTGCGGTGGAGCATGAGGCGGAGGGGAAGGAGAAAAAGGGATTTTTGG
ACAAAATTAAGGAGAAATTACCAGGATACCACTCAAAGACTGAAGAGGAAAAGGAGAAGGAAAAAAACTAAATTAAATGAATGTTTATTT
GTTGATGTTTTTTACTTTTGGGATGTTATGATTGTGTTTCTGTGTTGCTTTGGTTATTAAGTGTTTTTATTTCCTTCACTTTGTTTTTTG
GATTTTGAAGGATTTTGTTTAGTACTGTATTTGATATTTCTGTATGTAAGTGCATATATATTGTTTTGTATATGTGCCTTATGTGTATGA
AGTTTGATGATATGGATTTGTAAAATGCAGTTGATTTTAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAC


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
ci7 cold-stress inducible protein (C17)
Genomic locations (0)None
Library representation (13)  
mRNA member sequences (44)  
Alignment image suppressed for unigene with 44 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 2 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)