Unigene SGN-U269439

Unigene Basic Information 
Unigene ID: SGN-U269439
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 269439
mRNA sequence: Length: 844 bp

>SGN-U269439 Solanum tuberosum #4 (20 members)
TACAAACGCAGCCTCCCTCTTCCTTTTCCCCCTTCCCCTTTCCCCTTAGTTTCACAGATCTTTGTGTAATCAAGAATGGTGACTACCGGG
AAGAAATCGAAGAGGACCCATGAGAGCATTAACAACAGATTGGCTCTCGTAATGAAGAGTGGCAAGTACACTCTTGGTTACAAGACTGTG
CTCAAGACTCTCAGGACCTCAAAAGGGAAGTTGATATTGATATCAAACAACTGCCCACCTTTGAGGAAATCTGAGATTGAGTATTATGCT
ATGCTTGCTAAAGTTGGTGTTCACCATTTCAATGGAAACAATGTTGATCTTGGAACAGCATGTGGAAAGTTCCACCGTGTGTCATGCCTG
AGCATCATTGACCCAGGTGATTCCGACATTATCAAGTCTCTGCCTGGAGATCAGTAAGAGTTGGTGATCTAGTAGTCATTCCCTTTAAAC
AATCTAGAAAATGTTTTGCCGGGCTGCTCTAAACCATTTTACTGATGTTGAGAGAATCTGTAGTATCTTTTTGTTCTTTGTGTTTTGGAG
TTATACCAAGATTCTAGCGTATTTTGGTATTATCTAGTTTTGTTGGTTTTATCATTTCTCCAGAAGTTTGAGGCCAAATACATTATGATT
TATTCATAGATCAATTTCCCTTGATAATTTTGAATATCTGAATGAGTTCACTTGCTGATAAAAAGTTATTTCTTGATTTCCTGAAACTGT
GTATGGTATCTCTATATATATCTGTTTAGGACTCAAAAAAGGATTCTTTTCTGCTGCTGAACCAGAAGGGGAAGTTAATTGGAGATCTCA
TAAAGGATGGAAAACAGACAGATGGAAATGATGA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
X84380 X84380 genomic RNA expressed in roots
Genomic locations (0)None
Library representation (14)  
mRNA member sequences (20)  
Alignment image suppressed for unigene with 20 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 4 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)