Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Unigene SGN-U269469

Unigene Basic Information 
Unigene ID: SGN-U269469
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 269469
mRNA sequence: Length: 2057 bp

>SGN-U269469 Solanum tuberosum #4 (34 members)
AAAACAGAGCAGTTTTAGTTTAACAAAAATGGAGAATGGTACAAAAAGAGAAGGTTTAGGGAAACTTACAGTTTCATCTTCTCTACAAGT
TGAACAGCCTTTAGCACCATCAAAGCTATGGAAAATTATAGTTGTAGCTTCCATAGCTGCTGGTGTTCAATTTGGTTGGGCTCTTCAGCT
CTCTTTGCTTACACCTTATGTTCAATTGCTCGGAATTCCTCATAAATTTGCCTCTTTTATTTGGCTTTGTGGACCGATTTCTGGTATGAT
TGTTCAGCCAGTTGTCGGTTACTACAGTGATAATTGCTCCTCCCGTTTCGGTCGCCGCCGGCCATTCATTGCCGCCGGAGCTGCACTTGT
TATGATTGCGGTTTTCCTCATCGGATTCGCCGCCGACCTTGGTCATGCCTCCGGTGACACTCTCGGAAAAGGACTTAAGCCACGTGCCAT
TGCCGTTTTCGTCGTCGGCTTTTGGATCCTTGATGTTGCTAACAACATGTTACAGGGCCCATGCAGAGCACTACTGGCTGATCTCTCCGG
CGGAAAATCCGGCAGGATGAGAACAGCAAATGCTTTTTTCTCATTCTTCATGGCCGTCGGAAACATTCTGGGGTACGCCGCCGGTTCATA
TTCTCACCTCTTTAAAGTATTCCCCTTCTCAAAAACCAAAGCCTGCGACATGTACTGCGCAAATCTGAAGAGTTGTTTCTTCATCGCTAT
ATTCCTTTTACTCAGCTTAACAACCATAGCCTTAACCTTAGTCCGGGAAAACGAGCTCCCGGAGAAAGACGAGCAAGAAATCGACGAGAA
ATTAGCCGGCGCCGGAAAATCGAAAGTACCGTTTTTCGGTGAAATTTTTGGGGCTTTGAAAGAATTACCTCGACCGATGTGGATTCTTCT
ATTAGTAACCTGTTTGAACTGGATCGCGTGGTTTCCCTTTTTCTTATACGATACAGATTGGATGGCTAAGGAGGTTTTCGGTGGACAAGT
CGGTGATGCGAGGTTGTACGATTTGGGTGTACGCGCTGGTGCAATGGGATTACTGTTGCAATCTGTGGTTCTAGGGTTTATGTCACTTGG
GGTTGAATTCTTAGGGAAGAAGATTGGTGGTGCTAAGAGGTTATGGGGAATTTTGAACTTTGTTTTGGCTATTTGCTTGGCTATGACCAT
TTTGGTCACCAAAATGGCCGAGAAATCTCGCCAGCACGACCCCGCCGGCACACTTATGGGGCCGACGCCTGGTGTTAAAATCGGTGCCTT
GCTTCTCTTTGCCGCCCTTGGTATTCCTCTTGCGGCAACTTTTAGTATTCCATTTGCTTTGGCATCTATATTTTCTAGTAATGCTGGTTC
AGGACAAGGTTTGTCACTAGGAGTGCTCAATCTTGCAATTGTTGTACCACAGATGTTGGTGTCACTAGTAGGAGGGCCATGGGATGATTT
GTTTGGAGGAGGAAACTTGCCTGGATTTGTAGTTGGAGCAGTTGCAGCTGCCGCGAGCGGTGTTTTAGCACTCACAATGTTGCCATCTCC
ACCTGCTGATGCTAAGCCAGCAGTCGCCATGGGCGGTTTCCATTAAATAATTACAAAAGACGAAGAAGAAGGAGAAGAAACAACTTTTTT
TTTTAATATTAGTACTTCTCTTTTGTAAACTTTTTTTATTTTAGAAAACAAACATAACATGGAGGCTATCTTTACAAGTGGCATGTCCAT
GTATCTTGCTTTTTTCATAAAGCTCTTTAGTGGAAGAAGAATTAGAGGAAGTTTCCTTTTAATTTCTTCCAAACAAATGGGGTATGTGTA
GTTGTTTTCACTTTGTGTGTAACAAGAAAGTTGTCCAGTATTAACATGTCTGGGCAAATGCTTTGTACCTTACTATTTTTTTTTTGTAAT
TTTCTTCTTGGAAGGTAGGAAAAAAAGTGGTTGGAGGTGGAAGTGGGGTACTTTGGGTTGGTAGAAGGGGAGATTTAAGAAAAAATTGTA
CTTAAAAGTGAAATCAAAATTGATCTATCTTTCTCCTATCAAAAAAAAAAAAAAAAAACTCGAACTGTCTCTTCTCT


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
sut1 sucrose transporter 1sucrose transporter
Genomic locations (0)None
Library representation (14)  
mRNA member sequences (34)  
Alignment image suppressed for unigene with 34 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 7 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)